Incidental Mutation 'R0070:Cdh7'
ID64438
Institutional Source Beutler Lab
Gene Symbol Cdh7
Ensembl Gene ENSMUSG00000026312
Gene Namecadherin 7, type 2
SynonymsCDH7L1
MMRRC Submission 038361-MU
Accession Numbers

Ncbi RefSeq: NM_172853.2; MGI:2442792

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0070 (G1)
Quality Score115
Status Validated
Chromosome1
Chromosomal Location109982431-110140157 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 110098372 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 446 (A446V)
Ref Sequence ENSEMBL: ENSMUSP00000129715 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027542] [ENSMUST00000112701] [ENSMUST00000131464] [ENSMUST00000172005]
Predicted Effect probably benign
Transcript: ENSMUST00000027542
AA Change: A446V

PolyPhen 2 Score 0.365 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000027542
Gene: ENSMUSG00000026312
AA Change: A446V

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
CA 70 151 5.77e-16 SMART
CA 175 260 2.9e-30 SMART
CA 284 376 1.96e-18 SMART
CA 399 480 1.19e-26 SMART
CA 503 590 2.26e-9 SMART
transmembrane domain 606 628 N/A INTRINSIC
Pfam:Cadherin_C 633 778 6e-54 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112701
AA Change: A446V

PolyPhen 2 Score 0.365 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000108321
Gene: ENSMUSG00000026312
AA Change: A446V

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
CA 70 151 5.77e-16 SMART
CA 175 260 2.9e-30 SMART
CA 284 376 1.96e-18 SMART
CA 399 480 1.19e-26 SMART
CA 503 590 2.26e-9 SMART
transmembrane domain 606 628 N/A INTRINSIC
Pfam:Cadherin_C 631 779 4e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131464
SMART Domains Protein: ENSMUSP00000138046
Gene: ENSMUSG00000026312

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
PDB:1ZVN|B 49 70 1e-9 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000134301
SMART Domains Protein: ENSMUSP00000123394
Gene: ENSMUSG00000026312

DomainStartEndE-ValueType
CA 24 111 2.26e-9 SMART
transmembrane domain 125 147 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172005
AA Change: A446V

PolyPhen 2 Score 0.365 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000129715
Gene: ENSMUSG00000026312
AA Change: A446V

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
CA 70 151 5.77e-16 SMART
CA 175 260 2.9e-30 SMART
CA 284 376 1.96e-18 SMART
CA 399 480 1.19e-26 SMART
CA 503 590 2.26e-9 SMART
transmembrane domain 606 628 N/A INTRINSIC
Pfam:Cadherin_C 631 779 4e-58 PFAM
Meta Mutation Damage Score 0.1005 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 96.1%
Validation Efficiency 97% (68/70)
MGI Phenotype FUNCTION: This gene encodes a member of the cadherin family of calcium-dependent glycoproteins that mediate cell adhesion and regulate many morphogenetic events during development. The encoded preproprotein is further processed to generate a mature protein. Alternative splicing results in multiple transcript variants encoding different isoforms. This gene is located adjacent to a related cadherin gene on chromosome 1. [provided by RefSeq, Oct 2015]
Allele List at MGI

All alleles(1) : Targeted(1)

Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgre4 T C 17: 55,802,154 I387T probably damaging Het
Alpi A G 1: 87,101,159 probably benign Het
Ankfn1 A T 11: 89,392,302 L173Q probably damaging Het
Atp2a1 T C 7: 126,447,452 E892G probably benign Het
AU018091 T C 7: 3,158,898 probably null Het
Capn12 T C 7: 28,889,126 probably benign Het
Capn2 C A 1: 182,473,869 probably benign Het
Cd79b A G 11: 106,311,918 probably benign Het
Ciapin1 T C 8: 94,825,219 N246S possibly damaging Het
Cmip T A 8: 117,426,554 I270N probably damaging Het
Cyp2d40 A G 15: 82,760,774 V225A unknown Het
Dnah9 A G 11: 66,160,040 V142A probably benign Het
Fam126a T C 5: 23,964,999 S451G probably damaging Het
Flt3 A G 5: 147,372,726 probably benign Het
Gm10238 A G 15: 75,237,585 noncoding transcript Het
Gm4787 T A 12: 81,379,066 D106V probably damaging Het
Hipk2 G A 6: 38,818,984 R117* probably null Het
Ifna11 A G 4: 88,820,275 D106G possibly damaging Het
Igkv1-115 G A 6: 68,161,418 V2I probably benign Het
Itga6 T C 2: 71,826,716 probably benign Het
Kcnj6 C A 16: 94,941,197 K5N probably benign Het
Kcnt1 T C 2: 25,892,362 V191A probably benign Het
Lcorl G A 5: 45,733,701 R437C probably damaging Het
Man2a1 G A 17: 64,659,079 probably null Het
Map3k14 T A 11: 103,239,554 probably null Het
Mtch1 T A 17: 29,340,059 probably benign Het
Myo1c A G 11: 75,660,250 N217S probably benign Het
Olfr132 A G 17: 38,130,889 L101P probably damaging Het
Olfr1362 T C 13: 21,611,261 K236R possibly damaging Het
Orm3 A G 4: 63,356,646 T64A probably benign Het
Phf20l1 T G 15: 66,639,991 W940G probably damaging Het
Phldb1 C T 9: 44,707,904 R844H probably damaging Het
Piezo2 T C 18: 63,102,084 D814G probably damaging Het
Pkd2 T C 5: 104,466,990 C233R probably damaging Het
Prkd3 A G 17: 78,954,510 Y792H probably damaging Het
Pth1r A T 9: 110,727,550 probably null Het
Pxdn T C 12: 29,982,727 L146S probably damaging Het
Rnf32 A G 5: 29,225,127 T315A probably benign Het
Rpl5 T C 5: 107,901,900 Y12H probably benign Het
Serpinh1 A T 7: 99,349,314 S36R probably damaging Het
Setx A T 2: 29,161,525 T2030S probably benign Het
Sf3a3 G A 4: 124,714,955 V21I probably benign Het
Sin3b T A 8: 72,725,582 H105Q probably damaging Het
Slitrk1 T C 14: 108,913,317 probably benign Het
Slx4 A T 16: 3,988,016 D557E possibly damaging Het
Sprr3 C T 3: 92,457,302 M78I probably benign Het
Ssmem1 A G 6: 30,519,421 E35G possibly damaging Het
Stag1 C T 9: 100,956,408 P1238S probably null Het
Stra6 C T 9: 58,152,615 probably benign Het
Tmem127 T C 2: 127,257,059 V171A probably damaging Het
Tmem150a A G 6: 72,358,759 probably null Het
Top2a C G 11: 99,015,060 probably null Het
Ttn T C 2: 76,814,427 probably null Het
Tusc3 G A 8: 39,063,267 G129R possibly damaging Het
Uspl1 A G 5: 149,209,705 Y422C probably damaging Het
Vmn2r88 A T 14: 51,414,140 T312S probably benign Het
Wdr78 A T 4: 103,059,934 I571K probably damaging Het
Zc3hav1l A T 6: 38,295,190 S215T probably damaging Het
Zfp947 T A 17: 22,146,184 T170S probably benign Het
Other mutations in Cdh7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00742:Cdh7 APN 1 110065626 missense probably benign 0.22
IGL00861:Cdh7 APN 1 110060988 splice site probably benign
IGL01016:Cdh7 APN 1 110108956 critical splice donor site probably null
IGL01538:Cdh7 APN 1 110061140 missense probably damaging 1.00
IGL01763:Cdh7 APN 1 110065790 missense probably benign 0.00
IGL01765:Cdh7 APN 1 110061106 missense probably damaging 1.00
IGL01937:Cdh7 APN 1 110138096 missense probably benign
IGL02020:Cdh7 APN 1 110138348 missense probably damaging 1.00
IGL02135:Cdh7 APN 1 110138274 nonsense probably null
IGL02285:Cdh7 APN 1 110138191 missense probably damaging 1.00
IGL03237:Cdh7 APN 1 110138307 missense possibly damaging 0.89
IGL03280:Cdh7 APN 1 110108768 nonsense probably null
IGL03347:Cdh7 APN 1 110138243 missense possibly damaging 0.53
IGL03385:Cdh7 APN 1 110065786 missense possibly damaging 0.90
IGL02802:Cdh7 UTSW 1 110137925 missense probably damaging 1.00
R0030:Cdh7 UTSW 1 110138068 nonsense probably null
R0070:Cdh7 UTSW 1 110098372 missense probably benign 0.37
R0255:Cdh7 UTSW 1 109994306 missense probably benign 0.09
R0365:Cdh7 UTSW 1 110108756 missense probably damaging 1.00
R0506:Cdh7 UTSW 1 110100114 missense probably damaging 1.00
R0549:Cdh7 UTSW 1 110108944 missense probably damaging 1.00
R0599:Cdh7 UTSW 1 110052966 missense probably damaging 1.00
R0648:Cdh7 UTSW 1 110065607 splice site probably benign
R1033:Cdh7 UTSW 1 110085053 missense probably damaging 0.96
R1173:Cdh7 UTSW 1 110061132 missense probably benign 0.10
R1174:Cdh7 UTSW 1 110061132 missense probably benign 0.10
R1175:Cdh7 UTSW 1 110061132 missense probably benign 0.10
R1403:Cdh7 UTSW 1 110061132 missense probably benign 0.10
R1403:Cdh7 UTSW 1 110061132 missense probably benign 0.10
R1406:Cdh7 UTSW 1 110061132 missense probably benign 0.10
R1406:Cdh7 UTSW 1 110061132 missense probably benign 0.10
R1587:Cdh7 UTSW 1 110100027 missense probably damaging 0.98
R1728:Cdh7 UTSW 1 110065735 missense possibly damaging 0.53
R1729:Cdh7 UTSW 1 110065735 missense possibly damaging 0.53
R1730:Cdh7 UTSW 1 110065735 missense possibly damaging 0.53
R1739:Cdh7 UTSW 1 110065735 missense possibly damaging 0.53
R1762:Cdh7 UTSW 1 110065735 missense possibly damaging 0.53
R1769:Cdh7 UTSW 1 110052876 missense probably damaging 1.00
R1783:Cdh7 UTSW 1 110065735 missense possibly damaging 0.53
R1785:Cdh7 UTSW 1 110065735 missense possibly damaging 0.53
R1940:Cdh7 UTSW 1 110049024 missense probably benign 0.09
R1972:Cdh7 UTSW 1 110061132 missense probably benign 0.10
R1973:Cdh7 UTSW 1 110061132 missense probably benign 0.10
R1997:Cdh7 UTSW 1 110048938 missense probably damaging 1.00
R2060:Cdh7 UTSW 1 110048877 missense probably damaging 1.00
R2068:Cdh7 UTSW 1 110137936 nonsense probably null
R2069:Cdh7 UTSW 1 110138159 missense probably damaging 1.00
R2137:Cdh7 UTSW 1 110100106 missense probably damaging 0.97
R2155:Cdh7 UTSW 1 110048864 missense probably damaging 1.00
R3780:Cdh7 UTSW 1 110049004 missense probably benign 0.45
R3781:Cdh7 UTSW 1 110049004 missense probably benign 0.45
R3782:Cdh7 UTSW 1 110049004 missense probably benign 0.45
R4115:Cdh7 UTSW 1 110138309 missense probably benign 0.37
R4277:Cdh7 UTSW 1 110065688 missense probably benign 0.00
R4299:Cdh7 UTSW 1 110061001 missense probably damaging 0.99
R4777:Cdh7 UTSW 1 109994325 nonsense probably null
R4907:Cdh7 UTSW 1 110138323 missense probably damaging 1.00
R5045:Cdh7 UTSW 1 110098350 missense probably benign 0.01
R5059:Cdh7 UTSW 1 110065700 missense probably damaging 0.98
R5146:Cdh7 UTSW 1 109994312 missense probably damaging 0.97
R5196:Cdh7 UTSW 1 110138000 missense probably damaging 0.99
R5304:Cdh7 UTSW 1 110108839 missense probably damaging 1.00
R5496:Cdh7 UTSW 1 110048917 missense probably damaging 1.00
R5743:Cdh7 UTSW 1 110108845 missense probably damaging 1.00
R5867:Cdh7 UTSW 1 110048851 missense probably damaging 1.00
R6042:Cdh7 UTSW 1 110138267 missense probably damaging 0.97
R6092:Cdh7 UTSW 1 110098306 missense probably benign 0.00
R6497:Cdh7 UTSW 1 110065798 critical splice donor site probably null
R7111:Cdh7 UTSW 1 110137908 missense
R7511:Cdh7 UTSW 1 109997853 intron probably benign
R7532:Cdh7 UTSW 1 110138159 missense probably damaging 1.00
R7879:Cdh7 UTSW 1 110048947 missense probably benign 0.01
R7978:Cdh7 UTSW 1 109994105 start gained probably benign
R8022:Cdh7 UTSW 1 110061108 missense probably benign 0.02
R8207:Cdh7 UTSW 1 109994346 missense probably damaging 1.00
R8224:Cdh7 UTSW 1 109994203 missense probably benign
R8239:Cdh7 UTSW 1 110100102 missense probably benign 0.11
Z1088:Cdh7 UTSW 1 110085123 missense probably benign 0.01
Z1176:Cdh7 UTSW 1 110108736 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGGTCCAAAGATGACATGTGCTACTG -3'
(R):5'- CTTCAGAAGATAAGTCACGCCCTTCAG -3'

Sequencing Primer
(F):5'- GACATGTGCTACTGTAATTAGAAGG -3'
(R):5'- GCAGTATCTATGTAAGTTTCAGCAC -3'
Posted On2013-08-06