Incidental Mutation 'R8331:Greb1l'
ID644400
Institutional Source Beutler Lab
Gene Symbol Greb1l
Ensembl Gene ENSMUSG00000042942
Gene Namegrowth regulation by estrogen in breast cancer-like
SynonymsAK220484, mKIAA4095
MMRRC Submission
Accession Numbers

Genbank: NM_001083628; MGI: 3576497

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8331 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location10325177-10562934 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 10458706 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 96 (S96P)
Ref Sequence ENSEMBL: ENSMUSP00000049003 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048977] [ENSMUST00000172532]
Predicted Effect possibly damaging
Transcript: ENSMUST00000048977
AA Change: S96P

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000049003
Gene: ENSMUSG00000042942
AA Change: S96P

DomainStartEndE-ValueType
Pfam:GREB1 1 1172 N/A PFAM
Pfam:GREB1 1154 1913 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000172532
AA Change: S96P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134090
Gene: ENSMUSG00000042942
AA Change: S96P

DomainStartEndE-ValueType
low complexity region 83 100 N/A INTRINSIC
low complexity region 282 301 N/A INTRINSIC
low complexity region 606 617 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (75/75)
Allele List at MGI

All alleles(5) : Targeted, other(2) Gene trapped(3)

Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcd4 C A 12: 84,603,952 A545S probably damaging Het
Alox12e A T 11: 70,321,097 S195R probably benign Het
Angpt1 T C 15: 42,676,257 R69G probably damaging Het
Apob A G 12: 8,001,882 Q1149R probably benign Het
Arntl C A 7: 113,313,496 N586K probably benign Het
As3mt A T 19: 46,709,006 E71V probably damaging Het
Atp9a A T 2: 168,675,297 V372E probably benign Het
Bmp2k T C 5: 97,045,069 F259S probably damaging Het
Cacna1c T C 6: 118,630,329 T1364A Het
Casp7 T A 19: 56,440,965 I261N probably damaging Het
Ccdc151 C T 9: 21,991,711 R441H probably damaging Het
Ccdc154 A G 17: 25,167,953 K319E probably benign Het
Cdc42bpg C A 19: 6,313,447 L446I probably benign Het
Cdkl3 A T 11: 52,026,877 T334S probably benign Het
Cep250 T A 2: 155,990,253 L1366Q probably damaging Het
Chp2 G A 7: 122,221,910 D165N probably damaging Het
Ckap5 T A 2: 91,576,200 M782K probably damaging Het
Col20a1 T A 2: 180,996,766 I433N possibly damaging Het
Col4a2 A T 8: 11,413,985 R320* probably null Het
Ctsc A G 7: 88,297,120 H119R possibly damaging Het
Cubn T C 2: 13,340,242 H2121R probably damaging Het
Cyp4v3 G A 8: 45,315,708 R272* probably null Het
D630045J12Rik T C 6: 38,148,474 E1535G probably damaging Het
Dido1 A T 2: 180,660,449 D1887E probably benign Het
Dnah6 T C 6: 73,025,000 E3903G probably benign Het
Ep300 T C 15: 81,601,210 S133P unknown Het
Ercc3 T C 18: 32,240,818 S73P probably damaging Het
Fis1 T C 5: 136,963,133 probably null Het
Fscb T A 12: 64,473,468 D408V probably benign Het
Gm17087 A G 17: 8,566,707 W55R probably damaging Het
Gm3404 A T 5: 146,525,949 S41C probably damaging Het
Gm5580 T C 6: 116,552,362 I400T probably damaging Het
Irf3 C T 7: 45,000,959 P300S probably damaging Het
Klk1b4 G A 7: 44,211,575 C214Y probably damaging Het
Krtap5-3 T A 7: 142,201,826 C133* probably null Het
Map3k12 T A 15: 102,502,331 R448* probably null Het
Map4k2 C G 19: 6,352,823 A738G probably damaging Het
Matn2 A T 15: 34,428,681 K730N probably damaging Het
Mpp3 C T 11: 102,011,715 probably null Het
N4bp2 T A 5: 65,807,600 D997E probably damaging Het
Nav2 C T 7: 49,452,623 P390S probably benign Het
Nme8 A G 13: 19,658,866 S380P probably damaging Het
Nup210 C T 6: 91,053,666 D878N possibly damaging Het
Olfr1299 A G 2: 111,664,382 D52G possibly damaging Het
Olfr896-ps1 A G 9: 38,292,085 I47V possibly damaging Het
Osbpl9 C A 4: 109,066,181 W427L probably damaging Het
Pcdhb12 T C 18: 37,437,289 V496A probably damaging Het
Pdlim1 G A 19: 40,230,551 T212I possibly damaging Het
Phc2 C T 4: 128,712,194 Q270* probably null Het
Pi4kb G A 3: 94,996,684 R527Q probably null Het
Platr25 G T 13: 62,700,903 H48Q probably benign Het
Polr1a C T 6: 71,976,179 T1577M probably damaging Het
Ptprf C T 4: 118,226,066 V915M probably benign Het
Ptprh A G 7: 4,549,481 L928S probably damaging Het
Qrsl1 T C 10: 43,876,525 N434S probably damaging Het
Slc44a4 T A 17: 34,921,569 L246H probably damaging Het
Steap3 A T 1: 120,241,488 C360S possibly damaging Het
Stk10 A G 11: 32,588,928 T256A Het
Tatdn3 A T 1: 191,046,211 L261Q probably damaging Het
Thnsl1 T A 2: 21,212,174 F246L probably benign Het
Thsd7a A G 6: 12,471,158 V487A Het
Tmem41a A C 16: 21,947,366 probably null Het
Togaram2 G A 17: 71,729,226 V924M probably damaging Het
Trabd T C 15: 89,084,928 F185S probably damaging Het
Traf1 T C 2: 34,948,358 D156G probably damaging Het
Ttn T C 2: 76,880,138 E8513G unknown Het
Txlna C A 4: 129,639,486 S83I probably damaging Het
Utrn T G 10: 12,614,619 T6P probably benign Het
Vmn2r26 T A 6: 124,061,928 S821T probably benign Het
Wdhd1 A T 14: 47,272,245 probably null Het
Wnk1 T C 6: 119,953,833 I917V probably benign Het
Wscd2 A G 5: 113,550,935 M1V probably null Het
Xkr6 A G 14: 63,818,943 H357R unknown Het
Zfhx2 G T 14: 55,071,987 T885K probably benign Het
Zfp583 C T 7: 6,317,555 E153K probably benign Het
Zmynd11 A G 13: 9,695,154 M243T probably benign Het
Other mutations in Greb1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00485:Greb1l APN 18 10555962 missense possibly damaging 0.90
IGL01554:Greb1l APN 18 10522144 missense probably benign 0.01
IGL01563:Greb1l APN 18 10469399 missense probably damaging 0.99
IGL01944:Greb1l APN 18 10557280 missense possibly damaging 0.91
IGL02110:Greb1l APN 18 10515271 missense probably damaging 1.00
IGL02249:Greb1l APN 18 10532961 missense probably damaging 1.00
IGL02318:Greb1l APN 18 10469388 missense possibly damaging 0.91
IGL02340:Greb1l APN 18 10515200 missense probably damaging 0.99
IGL02516:Greb1l APN 18 10537064 missense probably benign 0.31
IGL02566:Greb1l APN 18 10503299 missense probably damaging 0.99
IGL02583:Greb1l APN 18 10542362 missense probably damaging 1.00
IGL02838:Greb1l APN 18 10560430 missense probably damaging 1.00
A4554:Greb1l UTSW 18 10532862 missense possibly damaging 0.58
PIT4453001:Greb1l UTSW 18 10533031 missense probably damaging 0.98
PIT4453001:Greb1l UTSW 18 10533032 missense probably benign 0.08
R0099:Greb1l UTSW 18 10509158 missense probably damaging 1.00
R0226:Greb1l UTSW 18 10522076 intron probably benign
R0234:Greb1l UTSW 18 10560331 missense probably damaging 1.00
R0234:Greb1l UTSW 18 10560331 missense probably damaging 1.00
R0239:Greb1l UTSW 18 10458567 splice site probably benign
R0316:Greb1l UTSW 18 10547420 missense probably damaging 1.00
R0369:Greb1l UTSW 18 10469375 missense possibly damaging 0.80
R0394:Greb1l UTSW 18 10523374 missense probably damaging 0.99
R0478:Greb1l UTSW 18 10509281 missense probably damaging 1.00
R0555:Greb1l UTSW 18 10458781 splice site probably benign
R0671:Greb1l UTSW 18 10474303 missense probably damaging 1.00
R1282:Greb1l UTSW 18 10547289 missense probably benign 0.13
R1574:Greb1l UTSW 18 10554997 missense possibly damaging 0.95
R1574:Greb1l UTSW 18 10554997 missense possibly damaging 0.95
R1607:Greb1l UTSW 18 10529703 missense possibly damaging 0.85
R1666:Greb1l UTSW 18 10501080 critical splice donor site probably null
R1666:Greb1l UTSW 18 10529708 critical splice donor site probably null
R1720:Greb1l UTSW 18 10553848 missense probably benign 0.19
R1808:Greb1l UTSW 18 10542143 missense probably benign
R1829:Greb1l UTSW 18 10509314 missense probably damaging 1.00
R1897:Greb1l UTSW 18 10498992 missense probably benign 0.00
R1967:Greb1l UTSW 18 10501049 missense possibly damaging 0.91
R2025:Greb1l UTSW 18 10515221 missense possibly damaging 0.71
R2086:Greb1l UTSW 18 10523281 missense probably damaging 1.00
R2125:Greb1l UTSW 18 10511422 missense probably damaging 0.98
R2139:Greb1l UTSW 18 10555011 missense probably damaging 1.00
R2255:Greb1l UTSW 18 10554857 missense probably damaging 1.00
R2256:Greb1l UTSW 18 10503307 missense possibly damaging 0.91
R2257:Greb1l UTSW 18 10503307 missense possibly damaging 0.91
R2880:Greb1l UTSW 18 10547288 missense possibly damaging 0.93
R3623:Greb1l UTSW 18 10542380 missense probably damaging 0.99
R3778:Greb1l UTSW 18 10469444 missense possibly damaging 0.60
R3975:Greb1l UTSW 18 10522247 missense possibly damaging 0.71
R4038:Greb1l UTSW 18 10515209 missense possibly damaging 0.93
R4062:Greb1l UTSW 18 10522150 missense probably damaging 0.99
R4134:Greb1l UTSW 18 10529708 critical splice donor site probably null
R4342:Greb1l UTSW 18 10544561 missense probably benign 0.12
R4409:Greb1l UTSW 18 10503182 missense possibly damaging 0.70
R4600:Greb1l UTSW 18 10553705 missense probably damaging 1.00
R4618:Greb1l UTSW 18 10498965 missense probably benign 0.00
R4683:Greb1l UTSW 18 10529563 splice site probably null
R4686:Greb1l UTSW 18 10522112 missense probably damaging 0.98
R4707:Greb1l UTSW 18 10532922 missense probably benign 0.02
R4780:Greb1l UTSW 18 10541792 missense probably benign 0.00
R4819:Greb1l UTSW 18 10458358 missense probably damaging 1.00
R4925:Greb1l UTSW 18 10547447 missense possibly damaging 0.79
R4960:Greb1l UTSW 18 10547306 missense probably damaging 0.99
R5150:Greb1l UTSW 18 10555950 frame shift probably null
R5154:Greb1l UTSW 18 10458312 missense probably benign 0.02
R5269:Greb1l UTSW 18 10511409 missense probably benign
R5290:Greb1l UTSW 18 10542427 missense probably damaging 1.00
R5310:Greb1l UTSW 18 10542427 missense probably damaging 1.00
R5328:Greb1l UTSW 18 10553720 missense probably damaging 1.00
R5337:Greb1l UTSW 18 10509143 missense probably damaging 1.00
R5393:Greb1l UTSW 18 10458312 missense probably benign 0.02
R5402:Greb1l UTSW 18 10537169 missense probably benign 0.26
R5718:Greb1l UTSW 18 10542427 missense probably damaging 1.00
R5719:Greb1l UTSW 18 10542427 missense probably damaging 1.00
R5720:Greb1l UTSW 18 10542427 missense probably damaging 1.00
R5721:Greb1l UTSW 18 10542427 missense probably damaging 1.00
R5902:Greb1l UTSW 18 10538302 missense probably benign 0.00
R5993:Greb1l UTSW 18 10544455 missense probably benign 0.10
R6035:Greb1l UTSW 18 10501025 missense possibly damaging 0.91
R6035:Greb1l UTSW 18 10501025 missense possibly damaging 0.91
R6045:Greb1l UTSW 18 10547068 missense probably damaging 1.00
R6063:Greb1l UTSW 18 10557340 missense probably damaging 1.00
R6297:Greb1l UTSW 18 10469494 missense probably damaging 1.00
R6405:Greb1l UTSW 18 10501076 missense probably benign 0.30
R6552:Greb1l UTSW 18 10541814 missense probably benign 0.00
R6572:Greb1l UTSW 18 10522131 missense probably benign 0.07
R6575:Greb1l UTSW 18 10547347 missense possibly damaging 0.88
R6922:Greb1l UTSW 18 10547482 missense possibly damaging 0.88
R6957:Greb1l UTSW 18 10558786 missense probably benign 0.23
R6962:Greb1l UTSW 18 10547327 missense probably damaging 1.00
R7012:Greb1l UTSW 18 10529707 critical splice donor site probably null
R7179:Greb1l UTSW 18 10544576 missense probably benign 0.00
R7251:Greb1l UTSW 18 10515319 missense probably damaging 1.00
R7275:Greb1l UTSW 18 10544561 missense probably benign 0.12
R7301:Greb1l UTSW 18 10544970 missense probably damaging 1.00
R7307:Greb1l UTSW 18 10538142 missense probably damaging 0.99
R7455:Greb1l UTSW 18 10554915 missense probably damaging 1.00
R7832:Greb1l UTSW 18 10542056 missense probably benign 0.38
R7934:Greb1l UTSW 18 10474371 nonsense probably null
R8137:Greb1l UTSW 18 10474357 missense possibly damaging 0.77
R8138:Greb1l UTSW 18 10533060 missense probably benign 0.13
R8208:Greb1l UTSW 18 10510703 missense probably damaging 1.00
R8227:Greb1l UTSW 18 10515371 missense probably damaging 1.00
R8312:Greb1l UTSW 18 10511587 intron probably benign
R8364:Greb1l UTSW 18 10529687 missense possibly damaging 0.85
R8389:Greb1l UTSW 18 10529613 missense probably benign 0.00
R8695:Greb1l UTSW 18 10544450 missense probably benign 0.01
R8795:Greb1l UTSW 18 10553739 missense probably damaging 0.98
R8836:Greb1l UTSW 18 10509257 missense probably benign 0.30
R8862:Greb1l UTSW 18 10555042 missense possibly damaging 0.90
R8872:Greb1l UTSW 18 10529684 missense probably benign 0.18
R8874:Greb1l UTSW 18 10544896 missense probably benign 0.01
R8886:Greb1l UTSW 18 10553843 missense not run
R8921:Greb1l UTSW 18 10541825 missense not run
Z1176:Greb1l UTSW 18 10515305 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GATTCCAAATCCTGGGAACTCAAAC -3'
(R):5'- GAGAGGACACAGTCACTCCTTC -3'

Sequencing Primer
(F):5'- ATGTTAAAAATGCTAGTCTCCCCC -3'
(R):5'- GGACACAGTCACTCCTTCCTTCAG -3'
Posted On2020-09-02