Incidental Mutation 'R8332:Xkr4'
ID644408
Institutional Source Beutler Lab
Gene Symbol Xkr4
Ensembl Gene ENSMUSG00000051951
Gene NameX-linked Kx blood group related 4
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8332 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location3205901-3671498 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 3421899 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 267 (Y267C)
Ref Sequence ENSEMBL: ENSMUSP00000070648 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070533]
Predicted Effect probably damaging
Transcript: ENSMUST00000070533
AA Change: Y267C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000070648
Gene: ENSMUSG00000051951
AA Change: Y267C

DomainStartEndE-ValueType
low complexity region 49 99 N/A INTRINSIC
Pfam:XK-related 111 513 2.6e-128 PFAM
low complexity region 573 586 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930412O13Rik G A 2: 9,882,839 R17H unknown Het
4933428G20Rik A T 11: 97,491,134 S61T unknown Het
8030411F24Rik A G 2: 148,783,457 K104E probably damaging Het
Abca14 A G 7: 120,216,213 D228G probably benign Het
Adgrv1 C T 13: 81,445,343 R4175H probably damaging Het
Ahdc1 A G 4: 133,063,971 D841G possibly damaging Het
Alms1 G A 6: 85,620,579 V796I probably benign Het
Angptl8 A T 9: 21,836,841 probably null Het
Bcl9 C T 3: 97,209,770 G536D possibly damaging Het
Bscl2 A G 19: 8,846,230 D220G probably benign Het
Ccl28 C A 13: 119,645,978 C58* probably null Het
Ccr8 A T 9: 120,094,374 Y185F probably damaging Het
Chsy3 T A 18: 59,409,015 H408Q probably damaging Het
Cntrl A G 2: 35,126,025 E351G probably damaging Het
Cog5 A T 12: 31,833,223 K384* probably null Het
Cpne1 T C 2: 156,078,397 T187A probably benign Het
Crat T A 2: 30,405,072 I444F possibly damaging Het
Crb1 T A 1: 139,237,414 M1052L probably damaging Het
Erp44 A G 4: 48,243,475 probably null Het
Flad1 G T 3: 89,407,521 Q290K probably benign Het
Gli3 G T 13: 15,713,548 R516L possibly damaging Het
Gm19402 A T 10: 77,690,214 C182S unknown Het
Herc2 T C 7: 56,146,595 I1905T probably damaging Het
Ikbkb A T 8: 22,665,625 V617D possibly damaging Het
Intu A G 3: 40,675,289 I350V probably benign Het
Limd1 A G 9: 123,479,254 D6G probably damaging Het
Llgl1 A G 11: 60,710,384 D716G possibly damaging Het
Lrp1 G A 10: 127,571,936 T1828I probably damaging Het
Olfr521 T C 7: 99,768,127 *322Q probably null Het
Olfr768 A G 10: 129,093,305 I223T possibly damaging Het
Piezo2 A T 18: 63,012,786 I2689N possibly damaging Het
Prag1 T C 8: 36,146,303 I1003T probably damaging Het
Rbm8a2 T C 1: 175,978,401 D170G unknown Het
Rnf213 A C 11: 119,483,698 Q5027P Het
Robo1 T C 16: 72,978,578 Y664H probably damaging Het
Rrn3 T A 16: 13,798,620 D287E possibly damaging Het
Slc22a16 G A 10: 40,573,745 R80Q possibly damaging Het
Slc4a4 A T 5: 89,179,821 T706S probably benign Het
Srek1ip1 A T 13: 104,834,249 R69S possibly damaging Het
St3gal5 T A 6: 72,142,181 C119* probably null Het
T2 A G 17: 8,390,952 M78V probably null Het
Taok1 A T 11: 77,541,719 V756D possibly damaging Het
Tecta C T 9: 42,375,014 G782D probably damaging Het
Thbs2 G A 17: 14,679,770 P615L probably damaging Het
Ttll11 T A 2: 35,940,709 I217F possibly damaging Het
Vmn2r57 C T 7: 41,400,253 V691M probably benign Het
Zfp59 A G 7: 27,853,546 D141G probably benign Het
Zfp760 A G 17: 21,723,320 E492G probably damaging Het
Other mutations in Xkr4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03398:Xkr4 APN 1 3216575 missense probably damaging 1.00
R0200:Xkr4 UTSW 1 3670663 missense probably benign 0.00
R0829:Xkr4 UTSW 1 3671246 missense possibly damaging 0.59
R0830:Xkr4 UTSW 1 3670745 missense possibly damaging 0.48
R0959:Xkr4 UTSW 1 3216674 missense probably damaging 1.00
R1242:Xkr4 UTSW 1 3216137 missense probably damaging 1.00
R1257:Xkr4 UTSW 1 3216813 missense probably benign 0.29
R2002:Xkr4 UTSW 1 3671095 missense probably benign
R3896:Xkr4 UTSW 1 3216191 missense probably damaging 0.99
R4006:Xkr4 UTSW 1 3421775 missense probably benign 0.01
R4173:Xkr4 UTSW 1 3216488 missense probably damaging 1.00
R4770:Xkr4 UTSW 1 3216491 missense probably damaging 1.00
R4868:Xkr4 UTSW 1 3216851 missense probably damaging 1.00
R5103:Xkr4 UTSW 1 3670688 missense probably benign
R5548:Xkr4 UTSW 1 3216930 missense probably damaging 1.00
R5602:Xkr4 UTSW 1 3216528 missense probably benign 0.18
R5608:Xkr4 UTSW 1 3671380 start gained probably benign
R5668:Xkr4 UTSW 1 3671035 missense probably damaging 1.00
R5901:Xkr4 UTSW 1 3216678 missense probably damaging 0.99
R6296:Xkr4 UTSW 1 3216570 missense probably benign 0.01
R6302:Xkr4 UTSW 1 3216738 missense probably damaging 0.99
R6326:Xkr4 UTSW 1 3671038 missense possibly damaging 0.75
R6341:Xkr4 UTSW 1 3670778 missense probably benign
R6911:Xkr4 UTSW 1 3671321 missense possibly damaging 0.91
R7086:Xkr4 UTSW 1 3216962 missense probably damaging 1.00
R7249:Xkr4 UTSW 1 3216810 missense probably damaging 1.00
R7571:Xkr4 UTSW 1 3670688 missense probably benign 0.00
R7881:Xkr4 UTSW 1 3216264 missense probably damaging 1.00
R7952:Xkr4 UTSW 1 3670619 missense possibly damaging 0.94
Z1176:Xkr4 UTSW 1 3670981 missense probably damaging 1.00
Z1176:Xkr4 UTSW 1 3670982 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCTGTAAGCTGTGAGTCTG -3'
(R):5'- TTCCTGAAAAGGGCTCTTATGGAG -3'

Sequencing Primer
(F):5'- GCTGTGAGTCTGTACAATAATGCAG -3'
(R):5'- TGATCTCCCGAACTGAGCTAGTAAG -3'
Posted On2020-09-02