Incidental Mutation 'R8332:Intu'
ID 644417
Institutional Source Beutler Lab
Gene Symbol Intu
Ensembl Gene ENSMUSG00000060798
Gene Name inturned planar cell polarity protein
Synonyms Pdzd6, Pdzk6, 9430087H23Rik, 9230116I04Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8332 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 40531286-40704774 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 40675289 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 350 (I350V)
Ref Sequence ENSEMBL: ENSMUSP00000088725 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091186]
AlphaFold Q059U7
Predicted Effect probably benign
Transcript: ENSMUST00000091186
AA Change: I350V

PolyPhen 2 Score 0.351 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000088725
Gene: ENSMUSG00000060798
AA Change: I350V

DomainStartEndE-ValueType
low complexity region 21 48 N/A INTRINSIC
low complexity region 64 81 N/A INTRINSIC
PDZ 187 269 2.09e-3 SMART
low complexity region 459 468 N/A INTRINSIC
low complexity region 774 784 N/A INTRINSIC
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mice show defective ciliogenesis and neural tube closure, abnormal patterning of the CNS and limbs, polydactyly, edema and death by E16.5. Homozygotes for a hypomorphic allele show defective ciliation and endochondral ossification, stunted growth, polydactyly and postnatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930412O13Rik G A 2: 9,882,839 R17H unknown Het
4933428G20Rik A T 11: 97,491,134 S61T unknown Het
8030411F24Rik A G 2: 148,783,457 K104E probably damaging Het
Abca14 A G 7: 120,216,213 D228G probably benign Het
Adgrv1 C T 13: 81,445,343 R4175H probably damaging Het
Ahdc1 A G 4: 133,063,971 D841G possibly damaging Het
Alms1 G A 6: 85,620,579 V796I probably benign Het
Angptl8 A T 9: 21,836,841 probably null Het
Bcl9 C T 3: 97,209,770 G536D possibly damaging Het
Bscl2 A G 19: 8,846,230 D220G probably benign Het
Ccl28 C A 13: 119,645,978 C58* probably null Het
Ccr8 A T 9: 120,094,374 Y185F probably damaging Het
Chsy3 T A 18: 59,409,015 H408Q probably damaging Het
Cntrl A G 2: 35,126,025 E351G probably damaging Het
Cog5 A T 12: 31,833,223 K384* probably null Het
Cpne1 T C 2: 156,078,397 T187A probably benign Het
Crat T A 2: 30,405,072 I444F possibly damaging Het
Crb1 T A 1: 139,237,414 M1052L probably damaging Het
Erp44 A G 4: 48,243,475 probably null Het
Flad1 G T 3: 89,407,521 Q290K probably benign Het
Gli3 G T 13: 15,713,548 R516L possibly damaging Het
Gm19402 A T 10: 77,690,214 C182S unknown Het
Herc2 T C 7: 56,146,595 I1905T probably damaging Het
Ikbkb A T 8: 22,665,625 V617D possibly damaging Het
Limd1 A G 9: 123,479,254 D6G probably damaging Het
Llgl1 A G 11: 60,710,384 D716G possibly damaging Het
Lrp1 G A 10: 127,571,936 T1828I probably damaging Het
Olfr521 T C 7: 99,768,127 *322Q probably null Het
Olfr768 A G 10: 129,093,305 I223T possibly damaging Het
Piezo2 A T 18: 63,012,786 I2689N possibly damaging Het
Prag1 T C 8: 36,146,303 I1003T probably damaging Het
Rbm8a2 T C 1: 175,978,401 D170G unknown Het
Rnf213 A C 11: 119,483,698 Q5027P Het
Robo1 T C 16: 72,978,578 Y664H probably damaging Het
Rrn3 T A 16: 13,798,620 D287E possibly damaging Het
Slc22a16 G A 10: 40,573,745 R80Q possibly damaging Het
Slc4a4 A T 5: 89,179,821 T706S probably benign Het
Srek1ip1 A T 13: 104,834,249 R69S possibly damaging Het
St3gal5 T A 6: 72,142,181 C119* probably null Het
T2 A G 17: 8,390,952 M78V probably null Het
Taok1 A T 11: 77,541,719 V756D possibly damaging Het
Tecta C T 9: 42,375,014 G782D probably damaging Het
Thbs2 G A 17: 14,679,770 P615L probably damaging Het
Ttll11 T A 2: 35,940,709 I217F possibly damaging Het
Vmn2r57 C T 7: 41,400,253 V691M probably benign Het
Xkr4 T C 1: 3,421,899 Y267C probably damaging Het
Zfp59 A G 7: 27,853,546 D141G probably benign Het
Zfp760 A G 17: 21,723,320 E492G probably damaging Het
Other mutations in Intu
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01292:Intu APN 3 40664266 missense probably benign 0.12
IGL01386:Intu APN 3 40692587 missense probably damaging 1.00
IGL02645:Intu APN 3 40701272 missense probably benign 0.01
IGL02869:Intu APN 3 40687786 missense probably damaging 1.00
IGL03263:Intu APN 3 40672597 nonsense probably null
H8562:Intu UTSW 3 40692673 missense probably damaging 1.00
PIT4495001:Intu UTSW 3 40697603 missense probably benign 0.07
R0010:Intu UTSW 3 40654272 intron probably benign
R0173:Intu UTSW 3 40675346 critical splice donor site probably null
R0426:Intu UTSW 3 40675305 missense probably damaging 0.97
R1566:Intu UTSW 3 40692578 missense probably damaging 0.99
R1619:Intu UTSW 3 40697631 nonsense probably null
R1658:Intu UTSW 3 40692781 missense probably benign 0.20
R1701:Intu UTSW 3 40664264 missense probably damaging 1.00
R1707:Intu UTSW 3 40540924 missense probably benign 0.03
R1707:Intu UTSW 3 40683501 missense possibly damaging 0.69
R1867:Intu UTSW 3 40664335 missense probably damaging 1.00
R1868:Intu UTSW 3 40664335 missense probably damaging 1.00
R2090:Intu UTSW 3 40683536 missense probably benign 0.00
R2310:Intu UTSW 3 40653813 missense probably benign
R2989:Intu UTSW 3 40692710 missense probably benign 0.11
R4168:Intu UTSW 3 40672623 missense probably benign 0.00
R4530:Intu UTSW 3 40683364 missense possibly damaging 0.95
R5093:Intu UTSW 3 40692917 missense probably benign 0.00
R5541:Intu UTSW 3 40692587 splice site probably null
R5587:Intu UTSW 3 40675308 missense probably damaging 0.99
R5745:Intu UTSW 3 40692972 splice site probably null
R5809:Intu UTSW 3 40679590 missense probably damaging 0.99
R5939:Intu UTSW 3 40692584 missense probably damaging 1.00
R5953:Intu UTSW 3 40679550 missense probably damaging 1.00
R6000:Intu UTSW 3 40654148 nonsense probably null
R6063:Intu UTSW 3 40654094 missense probably damaging 0.97
R6245:Intu UTSW 3 40675326 missense probably damaging 0.98
R6310:Intu UTSW 3 40701291 nonsense probably null
R6353:Intu UTSW 3 40653708 missense probably damaging 1.00
R6451:Intu UTSW 3 40701293 missense possibly damaging 0.94
R6660:Intu UTSW 3 40531951 missense probably benign 0.00
R6848:Intu UTSW 3 40694255 missense probably benign 0.00
R7440:Intu UTSW 3 40697551 missense probably benign 0.04
R7625:Intu UTSW 3 40697599 missense probably benign
R7633:Intu UTSW 3 40654253 missense probably damaging 1.00
R7798:Intu UTSW 3 40691929 missense probably damaging 1.00
R7877:Intu UTSW 3 40699792 missense probably benign 0.07
R7978:Intu UTSW 3 40697639 missense probably damaging 1.00
R8319:Intu UTSW 3 40653772 missense probably damaging 1.00
R8860:Intu UTSW 3 40672732 missense probably benign 0.07
R8926:Intu UTSW 3 40653709 missense possibly damaging 0.69
R8946:Intu UTSW 3 40683359 missense possibly damaging 0.93
R9164:Intu UTSW 3 40690703 missense probably damaging 1.00
R9191:Intu UTSW 3 40692511 missense probably damaging 0.99
R9547:Intu UTSW 3 40654106 missense probably benign
Z1177:Intu UTSW 3 40697516 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- TGAAACTCTGACTAAAGCTGAGG -3'
(R):5'- GACCATCCCAGACCTATAGCTG -3'

Sequencing Primer
(F):5'- AGGCTGAAAGGACTCCTATTTTG -3'
(R):5'- GCTGAATTAAAAACACACACTTGAG -3'
Posted On 2020-09-02