Incidental Mutation 'R0070:Itga6'
ID64442
Institutional Source Beutler Lab
Gene Symbol Itga6
Ensembl Gene ENSMUSG00000027111
Gene Nameintegrin alpha 6
SynonymsCd49f, 5033401O05Rik
MMRRC Submission 038361-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0070 (G1)
Quality Score84
Status Validated
Chromosome2
Chromosomal Location71745616-71858416 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 71826716 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000028522] [ENSMUST00000112101]
Predicted Effect probably benign
Transcript: ENSMUST00000028522
SMART Domains Protein: ENSMUSP00000028522
Gene: ENSMUSG00000027111

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Int_alpha 40 101 3.12e-6 SMART
Int_alpha 254 303 2.7e-1 SMART
Int_alpha 312 368 1.46e-11 SMART
Int_alpha 373 426 9.73e-17 SMART
Int_alpha 428 483 5.83e0 SMART
SCOP:d1m1xa2 629 786 5e-32 SMART
SCOP:d1m1xa3 797 1017 3e-55 SMART
Pfam:Integrin_alpha 1038 1052 3.2e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112101
SMART Domains Protein: ENSMUSP00000107729
Gene: ENSMUSG00000027111

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Int_alpha 40 101 3.12e-6 SMART
Int_alpha 254 303 2.7e-1 SMART
Int_alpha 312 368 1.46e-11 SMART
Int_alpha 373 426 9.73e-17 SMART
Int_alpha 428 483 5.83e0 SMART
SCOP:d1m1xa2 629 786 4e-32 SMART
SCOP:d1m1xa3 797 1017 4e-55 SMART
low complexity region 1058 1070 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000155249
SMART Domains Protein: ENSMUSP00000118086
Gene: ENSMUSG00000027111

DomainStartEndE-ValueType
Pfam:Integrin_alpha2 58 533 4.7e-131 PFAM
transmembrane domain 609 631 N/A INTRINSIC
Pfam:Integrin_alpha 632 646 6.2e-8 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 96.1%
Validation Efficiency 97% (68/70)
MGI Phenotype FUNCTION: This gene encodes a protein that is a member of the integrin superfamily. Integrins are transmembrane receptors involved cell adhesion and signaling, and they are subdivided based on the heterodimer formation of alpha and beta chains. This protein has been shown to heterodimerize with beta 4 to bind laminin and to form the main component of hemidesmosomes, which mediate attachment of epithelia to basement membranes. In mouse, deficiency of this gene is associated with absence of hemidesmosomes, severe skin blistering, and early post-natal death. In humans mutations of this gene are associated with epidermolysis bullosa. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, May 2013]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit severe blistering of the skin and other epithelia, absence of hemidesmosomes, altered laminin deposition in brain, and ectopic neuroblastic outgrowths on the brain and in the eye. Mutants die at birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgre4 T C 17: 55,802,154 I387T probably damaging Het
Alpi A G 1: 87,101,159 probably benign Het
Ankfn1 A T 11: 89,392,302 L173Q probably damaging Het
Atp2a1 T C 7: 126,447,452 E892G probably benign Het
AU018091 T C 7: 3,158,898 probably null Het
Capn12 T C 7: 28,889,126 probably benign Het
Capn2 C A 1: 182,473,869 probably benign Het
Cd79b A G 11: 106,311,918 probably benign Het
Cdh7 C T 1: 110,098,372 A446V probably benign Het
Ciapin1 T C 8: 94,825,219 N246S possibly damaging Het
Cmip T A 8: 117,426,554 I270N probably damaging Het
Cyp2d40 A G 15: 82,760,774 V225A unknown Het
Dnah9 A G 11: 66,160,040 V142A probably benign Het
Fam126a T C 5: 23,964,999 S451G probably damaging Het
Flt3 A G 5: 147,372,726 probably benign Het
Gm10238 A G 15: 75,237,585 noncoding transcript Het
Gm4787 T A 12: 81,379,066 D106V probably damaging Het
Hipk2 G A 6: 38,818,984 R117* probably null Het
Ifna11 A G 4: 88,820,275 D106G possibly damaging Het
Igkv1-115 G A 6: 68,161,418 V2I probably benign Het
Kcnj6 C A 16: 94,941,197 K5N probably benign Het
Kcnt1 T C 2: 25,892,362 V191A probably benign Het
Lcorl G A 5: 45,733,701 R437C probably damaging Het
Man2a1 G A 17: 64,659,079 probably null Het
Map3k14 T A 11: 103,239,554 probably null Het
Mtch1 T A 17: 29,340,059 probably benign Het
Myo1c A G 11: 75,660,250 N217S probably benign Het
Olfr132 A G 17: 38,130,889 L101P probably damaging Het
Olfr1362 T C 13: 21,611,261 K236R possibly damaging Het
Orm3 A G 4: 63,356,646 T64A probably benign Het
Phf20l1 T G 15: 66,639,991 W940G probably damaging Het
Phldb1 C T 9: 44,707,904 R844H probably damaging Het
Piezo2 T C 18: 63,102,084 D814G probably damaging Het
Pkd2 T C 5: 104,466,990 C233R probably damaging Het
Prkd3 A G 17: 78,954,510 Y792H probably damaging Het
Pth1r A T 9: 110,727,550 probably null Het
Pxdn T C 12: 29,982,727 L146S probably damaging Het
Rnf32 A G 5: 29,225,127 T315A probably benign Het
Rpl5 T C 5: 107,901,900 Y12H probably benign Het
Serpinh1 A T 7: 99,349,314 S36R probably damaging Het
Setx A T 2: 29,161,525 T2030S probably benign Het
Sf3a3 G A 4: 124,714,955 V21I probably benign Het
Sin3b T A 8: 72,725,582 H105Q probably damaging Het
Slitrk1 T C 14: 108,913,317 probably benign Het
Slx4 A T 16: 3,988,016 D557E possibly damaging Het
Sprr3 C T 3: 92,457,302 M78I probably benign Het
Ssmem1 A G 6: 30,519,421 E35G possibly damaging Het
Stag1 C T 9: 100,956,408 P1238S probably null Het
Stra6 C T 9: 58,152,615 probably benign Het
Tmem127 T C 2: 127,257,059 V171A probably damaging Het
Tmem150a A G 6: 72,358,759 probably null Het
Top2a C G 11: 99,015,060 probably null Het
Ttn T C 2: 76,814,427 probably null Het
Tusc3 G A 8: 39,063,267 G129R possibly damaging Het
Uspl1 A G 5: 149,209,705 Y422C probably damaging Het
Vmn2r88 A T 14: 51,414,140 T312S probably benign Het
Wdr78 A T 4: 103,059,934 I571K probably damaging Het
Zc3hav1l A T 6: 38,295,190 S215T probably damaging Het
Zfp947 T A 17: 22,146,184 T170S probably benign Het
Other mutations in Itga6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00832:Itga6 APN 2 71838262 splice site probably null
IGL00902:Itga6 APN 2 71849394 missense probably benign 0.39
IGL01360:Itga6 APN 2 71787326 splice site probably null
IGL01621:Itga6 APN 2 71825656 missense probably benign 0.02
IGL01877:Itga6 APN 2 71838280 missense probably benign
IGL02332:Itga6 APN 2 71838373 missense possibly damaging 0.63
IGL02556:Itga6 APN 2 71838683 missense probably benign 0.20
IGL02713:Itga6 APN 2 71816713 missense possibly damaging 0.79
IGL02811:Itga6 APN 2 71826732 missense probably damaging 0.98
IGL03171:Itga6 APN 2 71841329 critical splice donor site probably null
isle_royale UTSW 2 71787233 missense probably benign 0.04
PIT4418001:Itga6 UTSW 2 71834070 missense probably benign 0.06
R0611:Itga6 UTSW 2 71820060 missense possibly damaging 0.84
R1404:Itga6 UTSW 2 71838716 missense probably benign
R1404:Itga6 UTSW 2 71838716 missense probably benign
R1439:Itga6 UTSW 2 71834034 missense probably damaging 1.00
R1487:Itga6 UTSW 2 71843240 missense possibly damaging 0.87
R1713:Itga6 UTSW 2 71787202 missense probably benign
R1720:Itga6 UTSW 2 71820166 missense probably damaging 1.00
R1816:Itga6 UTSW 2 71840809 missense probably benign 0.00
R1866:Itga6 UTSW 2 71834070 missense probably benign
R2009:Itga6 UTSW 2 71816681 missense probably benign 0.26
R2018:Itga6 UTSW 2 71818484 missense probably benign 0.16
R2171:Itga6 UTSW 2 71820014 missense probably damaging 1.00
R2189:Itga6 UTSW 2 71825617 missense probably benign 0.00
R2289:Itga6 UTSW 2 71818529 missense probably damaging 0.99
R2399:Itga6 UTSW 2 71820014 missense probably damaging 1.00
R4437:Itga6 UTSW 2 71825638 missense probably benign 0.42
R4482:Itga6 UTSW 2 71855915 missense probably damaging 1.00
R4773:Itga6 UTSW 2 71822444 missense probably benign 0.13
R4786:Itga6 UTSW 2 71838690 missense possibly damaging 0.80
R4898:Itga6 UTSW 2 71838373 missense possibly damaging 0.77
R5074:Itga6 UTSW 2 71826435 missense probably benign
R5386:Itga6 UTSW 2 71841150 missense probably damaging 1.00
R5591:Itga6 UTSW 2 71840590 missense probably damaging 1.00
R6024:Itga6 UTSW 2 71787233 missense probably benign 0.04
R6174:Itga6 UTSW 2 71833709 missense possibly damaging 0.88
R6210:Itga6 UTSW 2 71834007 critical splice acceptor site probably null
R6432:Itga6 UTSW 2 71833772 missense possibly damaging 0.75
R6644:Itga6 UTSW 2 71841124 missense probably damaging 1.00
R7354:Itga6 UTSW 2 71820230 missense probably damaging 1.00
R7402:Itga6 UTSW 2 71853553 missense probably benign 0.05
R7479:Itga6 UTSW 2 71838336 nonsense probably null
R7635:Itga6 UTSW 2 71843233 missense probably benign 0.00
R7657:Itga6 UTSW 2 71846251 missense probably benign 0.40
R7737:Itga6 UTSW 2 71822443 missense probably benign 0.38
R7782:Itga6 UTSW 2 71841535 missense probably damaging 0.98
R8062:Itga6 UTSW 2 71841743 missense probably benign 0.11
R8312:Itga6 UTSW 2 71855953 missense probably benign
Predicted Primers PCR Primer
(F):5'- AAGCCGATTCGTCTAAATGGGACC -3'
(R):5'- GTGTAAGTGAGCCAAAGCCATCTCC -3'

Sequencing Primer
(F):5'- CCAAAGACTCGATGTTTGGAATCTC -3'
(R):5'- ctctttctctcttcctctcttcc -3'
Posted On2013-08-06