Incidental Mutation 'R0070:Tmem127'
List |< first << previous [record 58 of 69] next >> last >|
ID64443
Institutional Source Beutler Lab
Gene Symbol Tmem127
Ensembl Gene ENSMUSG00000034850
Gene Nametransmembrane protein 127
Synonyms2310003P10Rik
MMRRC Submission 038361-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0070 (G1)
Quality Score192
Status Validated
Chromosome2
Chromosomal Location127247908-127261107 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 127257059 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 171 (V171A)
Ref Sequence ENSEMBL: ENSMUSP00000035434 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035871] [ENSMUST00000174288] [ENSMUST00000174503]
Predicted Effect probably damaging
Transcript: ENSMUST00000035871
AA Change: V171A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000035434
Gene: ENSMUSG00000034850
AA Change: V171A

DomainStartEndE-ValueType
low complexity region 3 24 N/A INTRINSIC
Blast:Sec63 37 179 3e-98 BLAST
low complexity region 202 216 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000174288
AA Change: V87A

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000134629
Gene: ENSMUSG00000034850
AA Change: V87A

DomainStartEndE-ValueType
Blast:Sec63 1 95 1e-60 BLAST
low complexity region 118 132 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000174503
AA Change: V116A

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000133701
Gene: ENSMUSG00000034850
AA Change: V116A

DomainStartEndE-ValueType
low complexity region 3 24 N/A INTRINSIC
Blast:Sec63 37 124 8e-37 BLAST
Meta Mutation Damage Score 0.5766 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 96.1%
Validation Efficiency 97% (68/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane protein with 3 predicted transmembrane domains. The protein is associated with a subpopulation of vesicular organelles corresponding to early endosomal structures, with the Golgi, and with lysosomes, and may participate in protein trafficking between these structures. Mutations in this gene and several other genes cause pheochromocytomas. Alternatively spliced transcript variants encoding the same protein have been identified. [provided by RefSeq, Aug 2010]
PHENOTYPE: Lysosomal activity and endosomal fusion mediated by Rab5 were affected in mouse embryonic fibroblasts of homozygous null mutants [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgre4 T C 17: 55,802,154 I387T probably damaging Het
Alpi A G 1: 87,101,159 probably benign Het
Ankfn1 A T 11: 89,392,302 L173Q probably damaging Het
Atp2a1 T C 7: 126,447,452 E892G probably benign Het
AU018091 T C 7: 3,158,898 probably null Het
Capn12 T C 7: 28,889,126 probably benign Het
Capn2 C A 1: 182,473,869 probably benign Het
Cd79b A G 11: 106,311,918 probably benign Het
Cdh7 C T 1: 110,098,372 A446V probably benign Het
Ciapin1 T C 8: 94,825,219 N246S possibly damaging Het
Cmip T A 8: 117,426,554 I270N probably damaging Het
Cyp2d40 A G 15: 82,760,774 V225A unknown Het
Dnah9 A G 11: 66,160,040 V142A probably benign Het
Fam126a T C 5: 23,964,999 S451G probably damaging Het
Flt3 A G 5: 147,372,726 probably benign Het
Gm10238 A G 15: 75,237,585 noncoding transcript Het
Gm4787 T A 12: 81,379,066 D106V probably damaging Het
Hipk2 G A 6: 38,818,984 R117* probably null Het
Ifna11 A G 4: 88,820,275 D106G possibly damaging Het
Igkv1-115 G A 6: 68,161,418 V2I probably benign Het
Itga6 T C 2: 71,826,716 probably benign Het
Kcnj6 C A 16: 94,941,197 K5N probably benign Het
Kcnt1 T C 2: 25,892,362 V191A probably benign Het
Lcorl G A 5: 45,733,701 R437C probably damaging Het
Man2a1 G A 17: 64,659,079 probably null Het
Map3k14 T A 11: 103,239,554 probably null Het
Mtch1 T A 17: 29,340,059 probably benign Het
Myo1c A G 11: 75,660,250 N217S probably benign Het
Olfr132 A G 17: 38,130,889 L101P probably damaging Het
Olfr1362 T C 13: 21,611,261 K236R possibly damaging Het
Orm3 A G 4: 63,356,646 T64A probably benign Het
Phf20l1 T G 15: 66,639,991 W940G probably damaging Het
Phldb1 C T 9: 44,707,904 R844H probably damaging Het
Piezo2 T C 18: 63,102,084 D814G probably damaging Het
Pkd2 T C 5: 104,466,990 C233R probably damaging Het
Prkd3 A G 17: 78,954,510 Y792H probably damaging Het
Pth1r A T 9: 110,727,550 probably null Het
Pxdn T C 12: 29,982,727 L146S probably damaging Het
Rnf32 A G 5: 29,225,127 T315A probably benign Het
Rpl5 T C 5: 107,901,900 Y12H probably benign Het
Serpinh1 A T 7: 99,349,314 S36R probably damaging Het
Setx A T 2: 29,161,525 T2030S probably benign Het
Sf3a3 G A 4: 124,714,955 V21I probably benign Het
Sin3b T A 8: 72,725,582 H105Q probably damaging Het
Slitrk1 T C 14: 108,913,317 probably benign Het
Slx4 A T 16: 3,988,016 D557E possibly damaging Het
Sprr3 C T 3: 92,457,302 M78I probably benign Het
Ssmem1 A G 6: 30,519,421 E35G possibly damaging Het
Stag1 C T 9: 100,956,408 P1238S probably null Het
Stra6 C T 9: 58,152,615 probably benign Het
Tmem150a A G 6: 72,358,759 probably null Het
Top2a C G 11: 99,015,060 probably null Het
Ttn T C 2: 76,814,427 probably null Het
Tusc3 G A 8: 39,063,267 G129R possibly damaging Het
Uspl1 A G 5: 149,209,705 Y422C probably damaging Het
Vmn2r88 A T 14: 51,414,140 T312S probably benign Het
Wdr78 A T 4: 103,059,934 I571K probably damaging Het
Zc3hav1l A T 6: 38,295,190 S215T probably damaging Het
Zfp947 T A 17: 22,146,184 T170S probably benign Het
Other mutations in Tmem127
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01084:Tmem127 APN 2 127257086 missense probably damaging 1.00
IGL02108:Tmem127 APN 2 127257106 missense probably damaging 0.98
IGL02556:Tmem127 APN 2 127256002 splice site probably null
R0070:Tmem127 UTSW 2 127257059 missense probably damaging 1.00
R0765:Tmem127 UTSW 2 127257149 missense probably damaging 0.96
R1696:Tmem127 UTSW 2 127248707 missense probably damaging 0.98
R1827:Tmem127 UTSW 2 127256174 splice site probably null
R1828:Tmem127 UTSW 2 127256174 splice site probably null
R3498:Tmem127 UTSW 2 127256120 missense probably benign 0.27
R3684:Tmem127 UTSW 2 127248732 missense possibly damaging 0.72
R3950:Tmem127 UTSW 2 127248657 missense probably damaging 1.00
R5337:Tmem127 UTSW 2 127256145 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GGGCAAATCCTTTGAGACCTGGTG -3'
(R):5'- ATCCCTGGTTGGAAGGAGCTAGTG -3'

Sequencing Primer
(F):5'- CTTTGAGACCTGGTGAGAGG -3'
(R):5'- CTAAAGGCAGAGTGTCTCCTG -3'
Posted On2013-08-06