Incidental Mutation 'R8333:Slc40a1'
ID644457
Institutional Source Beutler Lab
Gene Symbol Slc40a1
Ensembl Gene ENSMUSG00000025993
Gene Namesolute carrier family 40 (iron-regulated transporter), member 1
SynonymsDusg, metal transporting protein 1, Ol5, ferroportin1, IREG1, Slc11a3, FPN1, Pcm, MTP1
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8333 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location45908068-45926523 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 45911279 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 338 (S338G)
Ref Sequence ENSEMBL: ENSMUSP00000027137 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027137]
Predicted Effect probably damaging
Transcript: ENSMUST00000027137
AA Change: S338G

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000027137
Gene: ENSMUSG00000025993
AA Change: S338G

DomainStartEndE-ValueType
Pfam:FPN1 22 530 5e-194 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cell membrane protein that may be involved in iron export from duodenal epithelial cells. Defects in this gene are a cause of hemochromatosis type 4 (HFE4). [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted mutation exhibit embryonic lethality before embryo turning. Mice heterozygous for a targeted mutation display decreased thermal response latency. Mice heterozygous for an ENU induced mutation display abnormal iron homeostasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Amigo2 T C 15: 97,245,285 T419A probably damaging Het
Baiap2l1 A C 5: 144,280,881 I298M possibly damaging Het
BC005624 G T 2: 30,973,736 A245D probably benign Het
Cdh23 T A 10: 60,314,611 I2527F probably damaging Het
Celsr1 T C 15: 86,031,414 H786R possibly damaging Het
Cerkl A G 2: 79,338,578 V427A possibly damaging Het
Cfap43 G T 19: 47,897,326 C283* probably null Het
Chfr G A 5: 110,154,937 A455T probably benign Het
Cldn13 T A 5: 134,914,996 I112F possibly damaging Het
Cyb5rl T A 4: 107,068,678 V19E probably benign Het
Dcp1a A G 14: 30,522,926 T570A possibly damaging Het
Dlgap2 T A 8: 14,778,295 C568S probably benign Het
Ecm2 T C 13: 49,518,383 L120P probably damaging Het
Gpr156 T C 16: 37,992,054 S251P probably damaging Het
Gpr182 T C 10: 127,749,921 N387S probably benign Het
Grid1 T C 14: 35,569,638 V834A possibly damaging Het
Igkv8-34 T C 6: 70,044,353 S42G probably benign Het
Kctd17 CAGCTGGAGGAGC CAGC 15: 78,436,913 probably benign Het
Lrrc19 T A 4: 94,639,350 D208V probably benign Het
Lrrc9 C T 12: 72,481,543 T872I probably benign Het
Mrpl13 A G 15: 55,557,283 M1T probably null Het
Ncapg C T 5: 45,674,463 T217I probably damaging Het
Nim1k G A 13: 119,712,486 P291S probably damaging Het
Olfr1077-ps1 A T 2: 86,526,071 Y35* probably null Het
Olfr251 G A 9: 38,378,616 G239D probably damaging Het
Padi6 T C 4: 140,737,376 M181V probably damaging Het
Pax7 T A 4: 139,830,203 I86F probably damaging Het
Pbk T A 14: 65,817,231 Y271N probably benign Het
Rabgap1 C T 2: 37,495,698 P492L probably benign Het
Rhno1 G T 6: 128,357,765 D198E probably damaging Het
Scn2a A C 2: 65,683,847 I292L probably benign Het
Slc45a3 A G 1: 131,978,190 Y317C probably damaging Het
Stard9 T A 2: 120,701,789 S2842R probably benign Het
Tle2 C T 10: 81,577,684 T119I probably damaging Het
Ttn C T 2: 76,723,594 V30922I possibly damaging Het
Usp33 C T 3: 152,374,660 P476L probably damaging Het
Wdr38 T C 2: 38,999,349 Y51H probably damaging Het
Other mutations in Slc40a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01548:Slc40a1 APN 1 45909492 missense probably benign 0.19
IGL01576:Slc40a1 APN 1 45909597 missense probably damaging 1.00
IGL02113:Slc40a1 APN 1 45910894 missense probably benign 0.33
IGL02116:Slc40a1 APN 1 45911528 missense probably benign 0.01
IGL02220:Slc40a1 APN 1 45911335 missense probably damaging 1.00
IGL02537:Slc40a1 APN 1 45911393 missense probably benign 0.01
IGL02574:Slc40a1 APN 1 45912374 missense possibly damaging 0.77
IGL02673:Slc40a1 APN 1 45918416 missense possibly damaging 0.82
IGL02794:Slc40a1 APN 1 45909508 nonsense probably null
R0376:Slc40a1 UTSW 1 45912491 splice site probably benign
R0417:Slc40a1 UTSW 1 45911374 missense possibly damaging 0.50
R1608:Slc40a1 UTSW 1 45911297 missense probably damaging 0.96
R1723:Slc40a1 UTSW 1 45924761 missense probably damaging 1.00
R1892:Slc40a1 UTSW 1 45911142 nonsense probably null
R2092:Slc40a1 UTSW 1 45909454 missense probably benign
R2303:Slc40a1 UTSW 1 45910884 splice site probably benign
R2365:Slc40a1 UTSW 1 45924713 splice site probably null
R3718:Slc40a1 UTSW 1 45910991 missense probably benign
R4689:Slc40a1 UTSW 1 45912313 missense probably benign 0.00
R4994:Slc40a1 UTSW 1 45909664 missense probably damaging 1.00
R5103:Slc40a1 UTSW 1 45918995 nonsense probably null
R5151:Slc40a1 UTSW 1 45911356 missense possibly damaging 0.84
R5364:Slc40a1 UTSW 1 45925223 missense probably damaging 0.96
R5404:Slc40a1 UTSW 1 45912328 missense probably damaging 1.00
R5531:Slc40a1 UTSW 1 45912338 missense probably damaging 1.00
R5841:Slc40a1 UTSW 1 45912349 missense probably damaging 1.00
R6440:Slc40a1 UTSW 1 45925262 start codon destroyed probably null 0.94
R6455:Slc40a1 UTSW 1 45918947 missense probably damaging 0.99
R6975:Slc40a1 UTSW 1 45909492 missense probably benign 0.19
R7085:Slc40a1 UTSW 1 45911528 missense probably benign
R7130:Slc40a1 UTSW 1 45921224 missense probably damaging 1.00
R7502:Slc40a1 UTSW 1 45918974 missense probably damaging 1.00
R7755:Slc40a1 UTSW 1 45911306 missense probably damaging 0.99
R8085:Slc40a1 UTSW 1 45918368 missense probably damaging 1.00
R8218:Slc40a1 UTSW 1 45910969 missense probably benign 0.03
R8308:Slc40a1 UTSW 1 45911020 missense probably benign 0.02
R8427:Slc40a1 UTSW 1 45912338 missense probably damaging 1.00
R8515:Slc40a1 UTSW 1 45912307 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGGCTTCCAGGCATGAATAC -3'
(R):5'- ATCTAATGGGTGAGAAAGACTCC -3'

Sequencing Primer
(F):5'- CTTCCAGGCATGAATACGGAGATC -3'
(R):5'- CTCCAACATCCGTGAACTTGAATGTG -3'
Posted On2020-09-02