Incidental Mutation 'R8333:Padi6'
ID 644471
Institutional Source Beutler Lab
Gene Symbol Padi6
Ensembl Gene ENSMUSG00000040935
Gene Name peptidyl arginine deiminase, type VI
Synonyms Padi5, Pad6, ePAD
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8333 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 140727355-140742643 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 140737376 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Valine at position 181 (M181V)
Ref Sequence ENSEMBL: ENSMUSP00000044044 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038749] [ENSMUST00000130267]
AlphaFold Q8K3V4
Predicted Effect probably damaging
Transcript: ENSMUST00000038749
AA Change: M181V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000044044
Gene: ENSMUSG00000040935
AA Change: M181V

DomainStartEndE-ValueType
Pfam:PAD_N 1 112 5.6e-38 PFAM
Pfam:PAD_M 114 269 6e-53 PFAM
Pfam:PAD 280 679 4.7e-149 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000130267
AA Change: M106V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000123490
Gene: ENSMUSG00000040935
AA Change: M106V

DomainStartEndE-ValueType
Pfam:PAD_M 39 191 1.1e-57 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the peptidyl arginine deiminase family of enzymes, which catalyze the post-translational deimination of proteins by converting arginine residues into citrullines in the presence of calcium ions. The family members have distinct substrate specificities and tissue-specific expression patterns. This protein may play a role in cytoskeletal reorganization in the egg and in early embryo development. [provided by RefSeq, Sep 2012]
PHENOTYPE: Mice homozygous for a null allele exhibit altered oocyte cytoplasmic structures that lead to a failure of zygotes to progress beyond the 2 cell stage and female infertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Amigo2 T C 15: 97,245,285 T419A probably damaging Het
Baiap2l1 A C 5: 144,280,881 I298M possibly damaging Het
BC005624 G T 2: 30,973,736 A245D probably benign Het
Cdh23 T A 10: 60,314,611 I2527F probably damaging Het
Celsr1 T C 15: 86,031,414 H786R possibly damaging Het
Cerkl A G 2: 79,338,578 V427A possibly damaging Het
Cfap43 G T 19: 47,897,326 C283* probably null Het
Chfr G A 5: 110,154,937 A455T probably benign Het
Cldn13 T A 5: 134,914,996 I112F possibly damaging Het
Cyb5rl T A 4: 107,068,678 V19E probably benign Het
Dcp1a A G 14: 30,522,926 T570A possibly damaging Het
Dlgap2 T A 8: 14,778,295 C568S probably benign Het
Ecm2 T C 13: 49,518,383 L120P probably damaging Het
Gpr156 T C 16: 37,992,054 S251P probably damaging Het
Gpr182 T C 10: 127,749,921 N387S probably benign Het
Grid1 T C 14: 35,569,638 V834A possibly damaging Het
Igkv8-34 T C 6: 70,044,353 S42G probably benign Het
Kctd17 CAGCTGGAGGAGC CAGC 15: 78,436,913 probably benign Het
Lrrc19 T A 4: 94,639,350 D208V probably benign Het
Lrrc9 C T 12: 72,481,543 T872I probably benign Het
Macf1 T C 4: 123,385,452 probably null Het
Mrpl13 A G 15: 55,557,283 M1T probably null Het
Ncapg C T 5: 45,674,463 T217I probably damaging Het
Nim1k G A 13: 119,712,486 P291S probably damaging Het
Olfr1077-ps1 A T 2: 86,526,071 Y35* probably null Het
Olfr251 G A 9: 38,378,616 G239D probably damaging Het
Pax7 T A 4: 139,830,203 I86F probably damaging Het
Pbk T A 14: 65,817,231 Y271N probably benign Het
Rabgap1 C T 2: 37,495,698 P492L probably benign Het
Rhno1 G T 6: 128,357,765 D198E probably damaging Het
Scn2a A C 2: 65,683,847 I292L probably benign Het
Slc40a1 T C 1: 45,911,279 S338G probably damaging Het
Slc45a3 A G 1: 131,978,190 Y317C probably damaging Het
Stard9 T A 2: 120,701,789 S2842R probably benign Het
Tle2 C T 10: 81,577,684 T119I probably damaging Het
Ttn C T 2: 76,723,594 V30922I possibly damaging Het
Usp33 C T 3: 152,374,660 P476L probably damaging Het
Wdr38 T C 2: 38,999,349 Y51H probably damaging Het
Other mutations in Padi6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00778:Padi6 APN 4 140727623 missense possibly damaging 0.56
IGL01013:Padi6 APN 4 140729003 missense probably damaging 0.98
IGL01068:Padi6 APN 4 140730953 missense possibly damaging 0.70
IGL01945:Padi6 APN 4 140741924 missense probably benign 0.24
streetwise UTSW 4 140741558 nonsense probably null
R0097:Padi6 UTSW 4 140730957 missense probably benign 0.09
R0097:Padi6 UTSW 4 140730957 missense probably benign 0.09
R0135:Padi6 UTSW 4 140737352 missense probably benign 0.04
R0437:Padi6 UTSW 4 140728929 missense probably benign 0.01
R1581:Padi6 UTSW 4 140735836 missense probably damaging 1.00
R2024:Padi6 UTSW 4 140728968 missense possibly damaging 0.78
R3150:Padi6 UTSW 4 140735389 missense probably damaging 1.00
R3176:Padi6 UTSW 4 140735389 missense probably damaging 1.00
R3177:Padi6 UTSW 4 140735389 missense probably damaging 1.00
R3276:Padi6 UTSW 4 140735389 missense probably damaging 1.00
R3277:Padi6 UTSW 4 140735389 missense probably damaging 1.00
R4168:Padi6 UTSW 4 140741934 missense probably damaging 0.99
R4727:Padi6 UTSW 4 140731195 missense probably damaging 1.00
R5063:Padi6 UTSW 4 140741880 missense probably benign 0.01
R5382:Padi6 UTSW 4 140731210 missense probably damaging 1.00
R5408:Padi6 UTSW 4 140727685 missense probably damaging 1.00
R5604:Padi6 UTSW 4 140731162 missense probably damaging 0.96
R5790:Padi6 UTSW 4 140732258 missense probably damaging 1.00
R7084:Padi6 UTSW 4 140741558 nonsense probably null
R7533:Padi6 UTSW 4 140731195 missense probably damaging 1.00
R7581:Padi6 UTSW 4 140728929 missense probably benign 0.01
R7662:Padi6 UTSW 4 140728995 missense probably benign 0.00
R7766:Padi6 UTSW 4 140730975 missense probably benign 0.02
R7872:Padi6 UTSW 4 140727762 missense probably damaging 1.00
R8347:Padi6 UTSW 4 140735408 missense probably benign 0.00
R8550:Padi6 UTSW 4 140732703 missense probably benign 0.15
R8979:Padi6 UTSW 4 140739163 missense probably benign 0.03
RF007:Padi6 UTSW 4 140729743 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTAGAGGAAGTACTGGGCCC -3'
(R):5'- GATGGGGCATTTGACCTCACAAG -3'

Sequencing Primer
(F):5'- GAAGTACTGGGCCCACCAC -3'
(R):5'- CAAGGTGGTAAGAACTCCTGATTCC -3'
Posted On 2020-09-02