Mutagenetix > Incidental Mutations

Incidental Mutation 'R8333:Chfr'

644473

Institutional Source

Beutler Lab

Gene Symbol

Chfr

Ensembl Gene

ENSMUSG00000014668

Gene Name

checkpoint with forkhead and ring finger domains

Synonyms

RNF116, 5730484M20Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.215) question?

Stock #

R8333 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

110135842-110171972 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 110154937 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Threonine at position 455 (A455T)

Ref Sequence

ENSEMBL: ENSMUSP00000108138 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000014812] [ENSMUST00000112519] [ENSMUST00000198066] [ENSMUST00000198633] [ENSMUST00000199557] [ENSMUST00000199672]

AlphaFold

Q810L3

Predicted Effect

probably benign
Transcript: ENSMUST00000014812
AA Change: A455T

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000014812
Gene: ENSMUSG00000014668
AA Change: A455T

Domain	Start	End	E-Value	Type
low complexity region	6	15	N/A	INTRINSIC
FHA	37	89	1.09e-6	SMART
low complexity region	203	215	N/A	INTRINSIC
RING	303	341	2.63e-4	SMART
low complexity region	396	421	N/A	INTRINSIC
RING	443	512	3.53e0	SMART
Blast:VWA	593	655	3e-12	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000112519
AA Change: A455T

PolyPhen 2 Score 0.050 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000108138
Gene: ENSMUSG00000014668
AA Change: A455T

Domain	Start	End	E-Value	Type
low complexity region	6	15	N/A	INTRINSIC
FHA	37	89	1.09e-6	SMART
low complexity region	203	215	N/A	INTRINSIC
RING	303	341	2.63e-4	SMART
low complexity region	396	421	N/A	INTRINSIC
RING	443	513	3.63e0	SMART
Blast:VWA	594	656	3e-12	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000198066

Predicted Effect

probably benign
Transcript: ENSMUST00000198633
AA Change: A383T

PolyPhen 2 Score 0.196 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000143480
Gene: ENSMUSG00000014668
AA Change: A383T

Domain	Start	End	E-Value	Type
low complexity region	6	15	N/A	INTRINSIC
FHA	37	89	1.09e-6	SMART
RING	231	269	2.63e-4	SMART
low complexity region	324	349	N/A	INTRINSIC
RING	371	441	3.63e0	SMART
Blast:VWA	522	584	2e-12	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000199557

SMART Domains

Protein: ENSMUSP00000143113
Gene: ENSMUSG00000014668

Domain	Start	End	E-Value	Type
SCOP:d1lgpa_	14	44	4e-5	SMART
PDB:1LGQ\|B	16	44	1e-10	PDB

Predicted Effect

probably benign
Transcript: ENSMUST00000199672

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.7%

Validation Efficiency

100% (39/39)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an E3 ubiquitin-protein ligase required for the maintenance of the antephase checkpoint that regulates cell cycle entry into mitosis and, therefore, may play a key role in cell cycle progression and tumorigenesis. The encoded protein has an N-terminal forkhead-associated domain, a central RING-finger domain, and a cysteine-rich C-terminal region. Alternatively spliced transcript variants that encode different protein isoforms have been described. [provided by RefSeq, Mar 2014]
PHENOTYPE: Homozygous null mice and MEFs display increased tumor incidence and inducibility, premature death, increased chromosomal instability, and cell cycle abnormalities. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Amigo2	T	C	15: 97,245,285	T419A	probably damaging	Het
Baiap2l1	A	C	5: 144,280,881	I298M	possibly damaging	Het
BC005624	G	T	2: 30,973,736	A245D	probably benign	Het
Cdh23	T	A	10: 60,314,611	I2527F	probably damaging	Het
Celsr1	T	C	15: 86,031,414	H786R	possibly damaging	Het
Cerkl	A	G	2: 79,338,578	V427A	possibly damaging	Het
Cfap43	G	T	19: 47,897,326	C283*	probably null	Het
Cldn13	T	A	5: 134,914,996	I112F	possibly damaging	Het
Cyb5rl	T	A	4: 107,068,678	V19E	probably benign	Het
Dcp1a	A	G	14: 30,522,926	T570A	possibly damaging	Het
Dlgap2	T	A	8: 14,778,295	C568S	probably benign	Het
Ecm2	T	C	13: 49,518,383	L120P	probably damaging	Het
Gpr156	T	C	16: 37,992,054	S251P	probably damaging	Het
Gpr182	T	C	10: 127,749,921	N387S	probably benign	Het
Grid1	T	C	14: 35,569,638	V834A	possibly damaging	Het
Igkv8-34	T	C	6: 70,044,353	S42G	probably benign	Het
Kctd17	CAGCTGGAGGAGC	CAGC	15: 78,436,913		probably benign	Het
Lrrc19	T	A	4: 94,639,350	D208V	probably benign	Het
Lrrc9	C	T	12: 72,481,543	T872I	probably benign	Het
Macf1	T	C	4: 123,385,452		probably null	Het
Mrpl13	A	G	15: 55,557,283	M1T	probably null	Het
Ncapg	C	T	5: 45,674,463	T217I	probably damaging	Het
Nim1k	G	A	13: 119,712,486	P291S	probably damaging	Het
Olfr1077-ps1	A	T	2: 86,526,071	Y35*	probably null	Het
Olfr251	G	A	9: 38,378,616	G239D	probably damaging	Het
Padi6	T	C	4: 140,737,376	M181V	probably damaging	Het
Pax7	T	A	4: 139,830,203	I86F	probably damaging	Het
Pbk	T	A	14: 65,817,231	Y271N	probably benign	Het
Rabgap1	C	T	2: 37,495,698	P492L	probably benign	Het
Rhno1	G	T	6: 128,357,765	D198E	probably damaging	Het
Scn2a	A	C	2: 65,683,847	I292L	probably benign	Het
Slc40a1	T	C	1: 45,911,279	S338G	probably damaging	Het
Slc45a3	A	G	1: 131,978,190	Y317C	probably damaging	Het
Stard9	T	A	2: 120,701,789	S2842R	probably benign	Het
Tle2	C	T	10: 81,577,684	T119I	probably damaging	Het
Ttn	C	T	2: 76,723,594	V30922I	possibly damaging	Het
Usp33	C	T	3: 152,374,660	P476L	probably damaging	Het
Wdr38	T	C	2: 38,999,349	Y51H	probably damaging	Het

Other mutations in Chfr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01333:Chfr	APN	5	110143573	missense	possibly damaging	0.94
IGL01479:Chfr	APN	5	110144993	unclassified	probably benign
IGL02543:Chfr	APN	5	110143547	splice site	probably null
IGL02657:Chfr	APN	5	110154839	missense	probably damaging	1.00
IGL03057:Chfr	APN	5	110143609	missense	probably benign	0.14
PIT4445001:Chfr	UTSW	5	110151677	missense	possibly damaging	0.88
R0938:Chfr	UTSW	5	110164058	missense	probably damaging	1.00
R1346:Chfr	UTSW	5	110140447	missense	probably damaging	1.00
R1561:Chfr	UTSW	5	110158808	missense	probably benign	0.05
R1602:Chfr	UTSW	5	110151665	missense	probably benign	0.26
R1658:Chfr	UTSW	5	110153169	missense	probably damaging	1.00
R2134:Chfr	UTSW	5	110144761	splice site	probably null
R2234:Chfr	UTSW	5	110170863	missense	probably damaging	1.00
R4371:Chfr	UTSW	5	110136168	missense	probably damaging	0.99
R4420:Chfr	UTSW	5	110170880	nonsense	probably null
R4666:Chfr	UTSW	5	110144867	nonsense	probably null
R4742:Chfr	UTSW	5	110143598	missense	probably benign	0.04
R4809:Chfr	UTSW	5	110158834	missense	probably damaging	1.00
R5490:Chfr	UTSW	5	110153129	missense	possibly damaging	0.88
R5581:Chfr	UTSW	5	110153282	critical splice donor site	probably null
R5820:Chfr	UTSW	5	110162739	missense	possibly damaging	0.94
R6012:Chfr	UTSW	5	110144651	critical splice donor site	probably null
R7128:Chfr	UTSW	5	110143636	missense	probably benign	0.33
R7166:Chfr	UTSW	5	110158805	missense	probably benign
R7278:Chfr	UTSW	5	110140360	missense	probably benign	0.23
R7393:Chfr	UTSW	5	110152358	missense	probably damaging	0.98
R7422:Chfr	UTSW	5	110162705	splice site	probably null
R7499:Chfr	UTSW	5	110151683	missense	probably benign	0.40
R8224:Chfr	UTSW	5	110160243	critical splice donor site	probably null
R8264:Chfr	UTSW	5	110152434	missense	possibly damaging	0.86
R8325:Chfr	UTSW	5	110162763	nonsense	probably null
R8823:Chfr	UTSW	5	110152392	missense	probably damaging	0.96
R9024:Chfr	UTSW	5	110158832	missense	probably benign	0.26
R9419:Chfr	UTSW	5	110169190	missense	probably damaging	1.00
X0013:Chfr	UTSW	5	110151579	missense	probably benign	0.19
Z1176:Chfr	UTSW	5	110144895	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- GGTAGAAGCCCAACACCTG -3'
(R):5'- CTACGAGAGGCAAAAGGATAGCT -3'

Sequencing Primer
(F):5'- CAACACCTGGAGCTAGGGGTTG -3'
(R):5'- GGCAAAAGGATAGCTGAAGC -3'

Posted On

2020-09-02