Incidental Mutation 'R8333:Chfr'
ID 644473
Institutional Source Beutler Lab
Gene Symbol Chfr
Ensembl Gene ENSMUSG00000014668
Gene Name checkpoint with forkhead and ring finger domains
Synonyms RNF116, 5730484M20Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.215) question?
Stock # R8333 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 110135842-110171972 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 110154937 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Threonine at position 455 (A455T)
Ref Sequence ENSEMBL: ENSMUSP00000108138 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014812] [ENSMUST00000112519] [ENSMUST00000198066] [ENSMUST00000198633] [ENSMUST00000199557] [ENSMUST00000199672]
AlphaFold Q810L3
Predicted Effect probably benign
Transcript: ENSMUST00000014812
AA Change: A455T

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000014812
Gene: ENSMUSG00000014668
AA Change: A455T

DomainStartEndE-ValueType
low complexity region 6 15 N/A INTRINSIC
FHA 37 89 1.09e-6 SMART
low complexity region 203 215 N/A INTRINSIC
RING 303 341 2.63e-4 SMART
low complexity region 396 421 N/A INTRINSIC
RING 443 512 3.53e0 SMART
Blast:VWA 593 655 3e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000112519
AA Change: A455T

PolyPhen 2 Score 0.050 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000108138
Gene: ENSMUSG00000014668
AA Change: A455T

DomainStartEndE-ValueType
low complexity region 6 15 N/A INTRINSIC
FHA 37 89 1.09e-6 SMART
low complexity region 203 215 N/A INTRINSIC
RING 303 341 2.63e-4 SMART
low complexity region 396 421 N/A INTRINSIC
RING 443 513 3.63e0 SMART
Blast:VWA 594 656 3e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000198066
Predicted Effect probably benign
Transcript: ENSMUST00000198633
AA Change: A383T

PolyPhen 2 Score 0.196 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000143480
Gene: ENSMUSG00000014668
AA Change: A383T

DomainStartEndE-ValueType
low complexity region 6 15 N/A INTRINSIC
FHA 37 89 1.09e-6 SMART
RING 231 269 2.63e-4 SMART
low complexity region 324 349 N/A INTRINSIC
RING 371 441 3.63e0 SMART
Blast:VWA 522 584 2e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000199557
SMART Domains Protein: ENSMUSP00000143113
Gene: ENSMUSG00000014668

DomainStartEndE-ValueType
SCOP:d1lgpa_ 14 44 4e-5 SMART
PDB:1LGQ|B 16 44 1e-10 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000199672
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an E3 ubiquitin-protein ligase required for the maintenance of the antephase checkpoint that regulates cell cycle entry into mitosis and, therefore, may play a key role in cell cycle progression and tumorigenesis. The encoded protein has an N-terminal forkhead-associated domain, a central RING-finger domain, and a cysteine-rich C-terminal region. Alternatively spliced transcript variants that encode different protein isoforms have been described. [provided by RefSeq, Mar 2014]
PHENOTYPE: Homozygous null mice and MEFs display increased tumor incidence and inducibility, premature death, increased chromosomal instability, and cell cycle abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Amigo2 T C 15: 97,245,285 T419A probably damaging Het
Baiap2l1 A C 5: 144,280,881 I298M possibly damaging Het
BC005624 G T 2: 30,973,736 A245D probably benign Het
Cdh23 T A 10: 60,314,611 I2527F probably damaging Het
Celsr1 T C 15: 86,031,414 H786R possibly damaging Het
Cerkl A G 2: 79,338,578 V427A possibly damaging Het
Cfap43 G T 19: 47,897,326 C283* probably null Het
Cldn13 T A 5: 134,914,996 I112F possibly damaging Het
Cyb5rl T A 4: 107,068,678 V19E probably benign Het
Dcp1a A G 14: 30,522,926 T570A possibly damaging Het
Dlgap2 T A 8: 14,778,295 C568S probably benign Het
Ecm2 T C 13: 49,518,383 L120P probably damaging Het
Gpr156 T C 16: 37,992,054 S251P probably damaging Het
Gpr182 T C 10: 127,749,921 N387S probably benign Het
Grid1 T C 14: 35,569,638 V834A possibly damaging Het
Igkv8-34 T C 6: 70,044,353 S42G probably benign Het
Kctd17 CAGCTGGAGGAGC CAGC 15: 78,436,913 probably benign Het
Lrrc19 T A 4: 94,639,350 D208V probably benign Het
Lrrc9 C T 12: 72,481,543 T872I probably benign Het
Macf1 T C 4: 123,385,452 probably null Het
Mrpl13 A G 15: 55,557,283 M1T probably null Het
Ncapg C T 5: 45,674,463 T217I probably damaging Het
Nim1k G A 13: 119,712,486 P291S probably damaging Het
Olfr1077-ps1 A T 2: 86,526,071 Y35* probably null Het
Olfr251 G A 9: 38,378,616 G239D probably damaging Het
Padi6 T C 4: 140,737,376 M181V probably damaging Het
Pax7 T A 4: 139,830,203 I86F probably damaging Het
Pbk T A 14: 65,817,231 Y271N probably benign Het
Rabgap1 C T 2: 37,495,698 P492L probably benign Het
Rhno1 G T 6: 128,357,765 D198E probably damaging Het
Scn2a A C 2: 65,683,847 I292L probably benign Het
Slc40a1 T C 1: 45,911,279 S338G probably damaging Het
Slc45a3 A G 1: 131,978,190 Y317C probably damaging Het
Stard9 T A 2: 120,701,789 S2842R probably benign Het
Tle2 C T 10: 81,577,684 T119I probably damaging Het
Ttn C T 2: 76,723,594 V30922I possibly damaging Het
Usp33 C T 3: 152,374,660 P476L probably damaging Het
Wdr38 T C 2: 38,999,349 Y51H probably damaging Het
Other mutations in Chfr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01333:Chfr APN 5 110143573 missense possibly damaging 0.94
IGL01479:Chfr APN 5 110144993 unclassified probably benign
IGL02543:Chfr APN 5 110143547 splice site probably null
IGL02657:Chfr APN 5 110154839 missense probably damaging 1.00
IGL03057:Chfr APN 5 110143609 missense probably benign 0.14
PIT4445001:Chfr UTSW 5 110151677 missense possibly damaging 0.88
R0938:Chfr UTSW 5 110164058 missense probably damaging 1.00
R1346:Chfr UTSW 5 110140447 missense probably damaging 1.00
R1561:Chfr UTSW 5 110158808 missense probably benign 0.05
R1602:Chfr UTSW 5 110151665 missense probably benign 0.26
R1658:Chfr UTSW 5 110153169 missense probably damaging 1.00
R2134:Chfr UTSW 5 110144761 splice site probably null
R2234:Chfr UTSW 5 110170863 missense probably damaging 1.00
R4371:Chfr UTSW 5 110136168 missense probably damaging 0.99
R4420:Chfr UTSW 5 110170880 nonsense probably null
R4666:Chfr UTSW 5 110144867 nonsense probably null
R4742:Chfr UTSW 5 110143598 missense probably benign 0.04
R4809:Chfr UTSW 5 110158834 missense probably damaging 1.00
R5490:Chfr UTSW 5 110153129 missense possibly damaging 0.88
R5581:Chfr UTSW 5 110153282 critical splice donor site probably null
R5820:Chfr UTSW 5 110162739 missense possibly damaging 0.94
R6012:Chfr UTSW 5 110144651 critical splice donor site probably null
R7128:Chfr UTSW 5 110143636 missense probably benign 0.33
R7166:Chfr UTSW 5 110158805 missense probably benign
R7278:Chfr UTSW 5 110140360 missense probably benign 0.23
R7393:Chfr UTSW 5 110152358 missense probably damaging 0.98
R7422:Chfr UTSW 5 110162705 splice site probably null
R7499:Chfr UTSW 5 110151683 missense probably benign 0.40
R8224:Chfr UTSW 5 110160243 critical splice donor site probably null
R8264:Chfr UTSW 5 110152434 missense possibly damaging 0.86
R8325:Chfr UTSW 5 110162763 nonsense probably null
R8823:Chfr UTSW 5 110152392 missense probably damaging 0.96
R9024:Chfr UTSW 5 110158832 missense probably benign 0.26
R9419:Chfr UTSW 5 110169190 missense probably damaging 1.00
X0013:Chfr UTSW 5 110151579 missense probably benign 0.19
Z1176:Chfr UTSW 5 110144895 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGTAGAAGCCCAACACCTG -3'
(R):5'- CTACGAGAGGCAAAAGGATAGCT -3'

Sequencing Primer
(F):5'- CAACACCTGGAGCTAGGGGTTG -3'
(R):5'- GGCAAAAGGATAGCTGAAGC -3'
Posted On 2020-09-02