Incidental Mutation 'R8333:Nim1k'
ID 644485
Institutional Source Beutler Lab
Gene Symbol Nim1k
Ensembl Gene ENSMUSG00000095930
Gene Name NIM1 serine/threonine protein kinase
Synonyms Nim1, E130304F04Rik
MMRRC Submission 067861-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8333 (G1)
Quality Score 225.009
Status Validated
Chromosome 13
Chromosomal Location 120171630-120217418 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 120174022 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Proline to Serine at position 291 (P291S)
Ref Sequence ENSEMBL: ENSMUSP00000136377 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000178142] [ENSMUST00000179869] [ENSMUST00000224188]
AlphaFold Q8BHI9
Predicted Effect probably damaging
Transcript: ENSMUST00000178142
AA Change: P291S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000136377
Gene: ENSMUSG00000095930
AA Change: P291S

DomainStartEndE-ValueType
S_TKc 74 325 8.66e-92 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000179869
SMART Domains Protein: ENSMUSP00000136944
Gene: ENSMUSG00000093930

DomainStartEndE-ValueType
Pfam:HMG_CoA_synt_N 13 186 4e-111 PFAM
Pfam:HMG_CoA_synt_C 187 469 4e-134 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000224188
Meta Mutation Damage Score 0.5742 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (39/39)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Amigo2 T C 15: 97,143,166 (GRCm39) T419A probably damaging Het
Baiap2l1 A C 5: 144,217,691 (GRCm39) I298M possibly damaging Het
BC005624 G T 2: 30,863,748 (GRCm39) A245D probably benign Het
Cdh23 T A 10: 60,150,390 (GRCm39) I2527F probably damaging Het
Celsr1 T C 15: 85,915,615 (GRCm39) H786R possibly damaging Het
Cerkl A G 2: 79,168,922 (GRCm39) V427A possibly damaging Het
Cfap43 G T 19: 47,885,765 (GRCm39) C283* probably null Het
Chfr G A 5: 110,302,803 (GRCm39) A455T probably benign Het
Cldn13 T A 5: 134,943,850 (GRCm39) I112F possibly damaging Het
Cyb5rl T A 4: 106,925,875 (GRCm39) V19E probably benign Het
Dcp1a A G 14: 30,244,883 (GRCm39) T570A possibly damaging Het
Dlgap2 T A 8: 14,828,295 (GRCm39) C568S probably benign Het
Ecm2 T C 13: 49,671,859 (GRCm39) L120P probably damaging Het
Gpr156 T C 16: 37,812,416 (GRCm39) S251P probably damaging Het
Gpr182 T C 10: 127,585,790 (GRCm39) N387S probably benign Het
Grid1 T C 14: 35,291,595 (GRCm39) V834A possibly damaging Het
Igkv8-34 T C 6: 70,021,337 (GRCm39) S42G probably benign Het
Kctd17 CAGCTGGAGGAGC CAGC 15: 78,321,113 (GRCm39) probably benign Het
Lrrc19 T A 4: 94,527,587 (GRCm39) D208V probably benign Het
Lrrc9 C T 12: 72,528,317 (GRCm39) T872I probably benign Het
Macf1 T C 4: 123,279,245 (GRCm39) probably null Het
Mrpl13 A G 15: 55,420,679 (GRCm39) M1T probably null Het
Ncapg C T 5: 45,831,805 (GRCm39) T217I probably damaging Het
Or8c11 G A 9: 38,289,912 (GRCm39) G239D probably damaging Het
Or8k31-ps1 A T 2: 86,356,415 (GRCm39) Y35* probably null Het
Padi6 T C 4: 140,464,687 (GRCm39) M181V probably damaging Het
Pax7 T A 4: 139,557,514 (GRCm39) I86F probably damaging Het
Pbk T A 14: 66,054,680 (GRCm39) Y271N probably benign Het
Rabgap1 C T 2: 37,385,710 (GRCm39) P492L probably benign Het
Rhno1 G T 6: 128,334,728 (GRCm39) D198E probably damaging Het
Scn2a A C 2: 65,514,191 (GRCm39) I292L probably benign Het
Slc40a1 T C 1: 45,950,439 (GRCm39) S338G probably damaging Het
Slc45a3 A G 1: 131,905,928 (GRCm39) Y317C probably damaging Het
Stard9 T A 2: 120,532,270 (GRCm39) S2842R probably benign Het
Tle2 C T 10: 81,413,518 (GRCm39) T119I probably damaging Het
Ttn C T 2: 76,553,938 (GRCm39) V30922I possibly damaging Het
Usp33 C T 3: 152,080,297 (GRCm39) P476L probably damaging Het
Wdr38 T C 2: 38,889,361 (GRCm39) Y51H probably damaging Het
Other mutations in Nim1k
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1334:Nim1k UTSW 13 120,174,024 (GRCm39) missense probably benign 0.05
R1782:Nim1k UTSW 13 120,173,687 (GRCm39) missense probably benign 0.00
R2216:Nim1k UTSW 13 120,175,751 (GRCm39) missense probably damaging 0.99
R3710:Nim1k UTSW 13 120,173,635 (GRCm39) missense probably benign
R4385:Nim1k UTSW 13 120,174,162 (GRCm39) missense probably damaging 0.98
R4430:Nim1k UTSW 13 120,174,078 (GRCm39) missense possibly damaging 0.63
R4484:Nim1k UTSW 13 120,173,710 (GRCm39) nonsense probably null
R4812:Nim1k UTSW 13 120,173,920 (GRCm39) missense probably benign
R5383:Nim1k UTSW 13 120,189,335 (GRCm39) missense probably benign 0.25
R5436:Nim1k UTSW 13 120,189,065 (GRCm39) intron probably benign
R5511:Nim1k UTSW 13 120,189,130 (GRCm39) missense probably damaging 1.00
R6682:Nim1k UTSW 13 120,173,724 (GRCm39) missense probably benign 0.09
R6922:Nim1k UTSW 13 120,189,263 (GRCm39) missense probably damaging 0.99
R7053:Nim1k UTSW 13 120,189,145 (GRCm39) missense probably damaging 1.00
R7455:Nim1k UTSW 13 120,173,995 (GRCm39) missense probably damaging 1.00
R8168:Nim1k UTSW 13 120,174,288 (GRCm39) missense probably damaging 1.00
R8401:Nim1k UTSW 13 120,174,213 (GRCm39) missense probably damaging 1.00
R8411:Nim1k UTSW 13 120,175,807 (GRCm39) missense possibly damaging 0.95
R8515:Nim1k UTSW 13 120,173,986 (GRCm39) nonsense probably null
R8540:Nim1k UTSW 13 120,175,718 (GRCm39) missense probably benign 0.34
R8915:Nim1k UTSW 13 120,173,874 (GRCm39) missense probably benign 0.10
R9227:Nim1k UTSW 13 120,174,118 (GRCm39) missense probably damaging 1.00
R9416:Nim1k UTSW 13 120,189,362 (GRCm39) missense probably benign
Z1177:Nim1k UTSW 13 120,189,238 (GRCm39) missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CTGGTTTCCGACAAATGTTTGG -3'
(R):5'- GGGAGATTTTGGATTCAGCACAG -3'

Sequencing Primer
(F):5'- CCGACAAATGTTTGGGATCC -3'
(R):5'- GCGAGATGCTGAACACTTTC -3'
Posted On 2020-09-02