Incidental Mutation 'R8333:Grid1'
ID644487
Institutional Source Beutler Lab
Gene Symbol Grid1
Ensembl Gene ENSMUSG00000041078
Gene Nameglutamate receptor, ionotropic, delta 1
SynonymsGluRdelta1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R8333 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location34820108-35583379 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 35569638 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 834 (V834A)
Ref Sequence ENSEMBL: ENSMUSP00000044009 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043349]
Predicted Effect possibly damaging
Transcript: ENSMUST00000043349
AA Change: V834A

PolyPhen 2 Score 0.825 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000044009
Gene: ENSMUSG00000041078
AA Change: V834A

DomainStartEndE-ValueType
Pfam:ANF_receptor 36 400 4.1e-51 PFAM
PBPe 438 807 4.68e-110 SMART
Lig_chan-Glu_bd 448 510 8.18e-25 SMART
low complexity region 838 853 N/A INTRINSIC
low complexity region 943 958 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of glutamate receptor channels. These channels mediate most of the fast excitatory synaptic transmission in the central nervous system and play key roles in synaptic plasticity.[provided by RefSeq, Jan 2009]
PHENOTYPE: Homozygotes for a targeted null mutation display a significant high-frequency hearing loss, associated with reductions of both cochlear outer hair cell function and endolymphatic potential, as well as increased vulnerability to acoustic injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Amigo2 T C 15: 97,245,285 T419A probably damaging Het
Baiap2l1 A C 5: 144,280,881 I298M possibly damaging Het
BC005624 G T 2: 30,973,736 A245D probably benign Het
Cdh23 T A 10: 60,314,611 I2527F probably damaging Het
Celsr1 T C 15: 86,031,414 H786R possibly damaging Het
Cerkl A G 2: 79,338,578 V427A possibly damaging Het
Cfap43 G T 19: 47,897,326 C283* probably null Het
Chfr G A 5: 110,154,937 A455T probably benign Het
Cldn13 T A 5: 134,914,996 I112F possibly damaging Het
Cyb5rl T A 4: 107,068,678 V19E probably benign Het
Dcp1a A G 14: 30,522,926 T570A possibly damaging Het
Dlgap2 T A 8: 14,778,295 C568S probably benign Het
Ecm2 T C 13: 49,518,383 L120P probably damaging Het
Gpr156 T C 16: 37,992,054 S251P probably damaging Het
Gpr182 T C 10: 127,749,921 N387S probably benign Het
Igkv8-34 T C 6: 70,044,353 S42G probably benign Het
Kctd17 CAGCTGGAGGAGC CAGC 15: 78,436,913 probably benign Het
Lrrc19 T A 4: 94,639,350 D208V probably benign Het
Lrrc9 C T 12: 72,481,543 T872I probably benign Het
Mrpl13 A G 15: 55,557,283 M1T probably null Het
Ncapg C T 5: 45,674,463 T217I probably damaging Het
Nim1k G A 13: 119,712,486 P291S probably damaging Het
Olfr1077-ps1 A T 2: 86,526,071 Y35* probably null Het
Olfr251 G A 9: 38,378,616 G239D probably damaging Het
Padi6 T C 4: 140,737,376 M181V probably damaging Het
Pax7 T A 4: 139,830,203 I86F probably damaging Het
Pbk T A 14: 65,817,231 Y271N probably benign Het
Rabgap1 C T 2: 37,495,698 P492L probably benign Het
Rhno1 G T 6: 128,357,765 D198E probably damaging Het
Scn2a A C 2: 65,683,847 I292L probably benign Het
Slc40a1 T C 1: 45,911,279 S338G probably damaging Het
Slc45a3 A G 1: 131,978,190 Y317C probably damaging Het
Stard9 T A 2: 120,701,789 S2842R probably benign Het
Tle2 C T 10: 81,577,684 T119I probably damaging Het
Ttn C T 2: 76,723,594 V30922I possibly damaging Het
Usp33 C T 3: 152,374,660 P476L probably damaging Het
Wdr38 T C 2: 38,999,349 Y51H probably damaging Het
Other mutations in Grid1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00705:Grid1 APN 14 35445887 missense possibly damaging 0.70
IGL01016:Grid1 APN 14 34822639 nonsense probably null
IGL01643:Grid1 APN 14 35323435 critical splice donor site probably null
IGL01697:Grid1 APN 14 35309257 missense probably benign 0.21
IGL01879:Grid1 APN 14 35450370 missense possibly damaging 0.93
IGL01975:Grid1 APN 14 35323426 missense probably benign
IGL02515:Grid1 APN 14 35452345 missense probably damaging 0.99
IGL02935:Grid1 APN 14 34822558 missense possibly damaging 0.86
IGL03279:Grid1 APN 14 34945765 missense probably damaging 0.98
IGL03286:Grid1 APN 14 35520685 splice site probably benign
IGL03296:Grid1 APN 14 35580567 missense possibly damaging 0.52
IGL03305:Grid1 APN 14 35251707 missense probably damaging 1.00
R0533:Grid1 UTSW 14 35309385 missense possibly damaging 0.84
R0746:Grid1 UTSW 14 34822690 missense possibly damaging 0.92
R0811:Grid1 UTSW 14 34822619 missense probably benign
R0812:Grid1 UTSW 14 34822619 missense probably benign
R1144:Grid1 UTSW 14 35562676 splice site probably benign
R1217:Grid1 UTSW 14 34820229 start codon destroyed probably null 0.53
R1485:Grid1 UTSW 14 34822583 missense probably damaging 1.00
R1529:Grid1 UTSW 14 35309293 missense probably benign 0.36
R1606:Grid1 UTSW 14 35445965 missense probably damaging 0.96
R1691:Grid1 UTSW 14 35452329 missense probably damaging 1.00
R1759:Grid1 UTSW 14 35446031 missense possibly damaging 0.92
R2374:Grid1 UTSW 14 35321807 splice site probably benign
R2415:Grid1 UTSW 14 35450369 missense possibly damaging 0.69
R2866:Grid1 UTSW 14 35562559 missense probably damaging 1.00
R3915:Grid1 UTSW 14 35520727 missense probably damaging 1.00
R4044:Grid1 UTSW 14 35450401 splice site probably benign
R4364:Grid1 UTSW 14 34946032 missense probably benign 0.20
R4691:Grid1 UTSW 14 35569557 missense probably benign
R4694:Grid1 UTSW 14 35026780 missense probably damaging 1.00
R4749:Grid1 UTSW 14 35580687 missense possibly damaging 0.50
R4794:Grid1 UTSW 14 34822622 missense probably damaging 0.99
R4854:Grid1 UTSW 14 35321641 missense probably benign
R5555:Grid1 UTSW 14 35520705 missense possibly damaging 0.92
R6005:Grid1 UTSW 14 35323412 missense probably damaging 1.00
R6176:Grid1 UTSW 14 35562547 missense probably benign 0.00
R6569:Grid1 UTSW 14 35323339 missense possibly damaging 0.72
R6911:Grid1 UTSW 14 34820228 start codon destroyed probably benign 0.08
R7504:Grid1 UTSW 14 35562513 missense probably damaging 1.00
R7744:Grid1 UTSW 14 35450079 missense probably damaging 1.00
R7795:Grid1 UTSW 14 35321685 missense probably damaging 1.00
R7883:Grid1 UTSW 14 35450302 splice site probably null
R7913:Grid1 UTSW 14 35569697 missense probably damaging 0.99
R8032:Grid1 UTSW 14 35323359 missense probably benign 0.00
U24488:Grid1 UTSW 14 35580577 missense probably benign 0.00
Z1088:Grid1 UTSW 14 35452294 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCAATGGCTATGGCTCACC -3'
(R):5'- TGCTGCTGTGTCCAGACAAG -3'

Sequencing Primer
(F):5'- CACCTGTGTTGTATCTTGCAGGATC -3'
(R):5'- TGTGTCCAGACAAGGTGACTC -3'
Posted On2020-09-02