Incidental Mutation 'R8333:Kctd17'
ID 644490
Institutional Source Beutler Lab
Gene Symbol Kctd17
Ensembl Gene ENSMUSG00000033287
Gene Name potassium channel tetramerisation domain containing 17
Synonyms 2900008M13Rik
MMRRC Submission 067861-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8333 (G1)
Quality Score 217.468
Status Validated
Chromosome 15
Chromosomal Location 78312764-78323503 bp(+) (GRCm39)
Type of Mutation unclassified
DNA Base Change (assembly) CAGCTGGAGGAGC to CAGC at 78321113 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000155401 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017086] [ENSMUST00000089414] [ENSMUST00000159771] [ENSMUST00000162321] [ENSMUST00000162517] [ENSMUST00000166142] [ENSMUST00000229290] [ENSMUST00000229622] [ENSMUST00000230020] [ENSMUST00000230226]
AlphaFold E0CYQ0
Predicted Effect probably benign
Transcript: ENSMUST00000017086
SMART Domains Protein: ENSMUSP00000017086
Gene: ENSMUSG00000016942

DomainStartEndE-ValueType
low complexity region 19 39 N/A INTRINSIC
transmembrane domain 57 79 N/A INTRINSIC
Pfam:SEA 88 191 3.2e-13 PFAM
CUB 341 452 3.82e-2 SMART
LDLa 457 489 1.33e-2 SMART
LDLa 490 527 2.31e-9 SMART
LDLa 530 568 1.07e-4 SMART
Tryp_SPc 576 806 3.75e-97 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000089414
SMART Domains Protein: ENSMUSP00000086835
Gene: ENSMUSG00000033287

DomainStartEndE-ValueType
low complexity region 12 30 N/A INTRINSIC
BTB 31 132 1.76e-16 SMART
coiled coil region 208 244 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159771
SMART Domains Protein: ENSMUSP00000125574
Gene: ENSMUSG00000033287

DomainStartEndE-ValueType
low complexity region 5 23 N/A INTRINSIC
BTB 24 125 1.76e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162321
SMART Domains Protein: ENSMUSP00000125680
Gene: ENSMUSG00000033287

DomainStartEndE-ValueType
BTB 3 86 9.93e-2 SMART
low complexity region 168 195 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162517
SMART Domains Protein: ENSMUSP00000124290
Gene: ENSMUSG00000033287

DomainStartEndE-ValueType
low complexity region 12 30 N/A INTRINSIC
BTB 31 132 1.76e-16 SMART
low complexity region 227 235 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162808
SMART Domains Protein: ENSMUSP00000125421
Gene: ENSMUSG00000033287

DomainStartEndE-ValueType
SCOP:d3kvt__ 2 36 3e-8 SMART
Blast:BTB 2 98 6e-30 BLAST
PDB:3DRY|E 2 127 4e-69 PDB
low complexity region 130 157 N/A INTRINSIC
low complexity region 160 187 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166142
SMART Domains Protein: ENSMUSP00000133210
Gene: ENSMUSG00000033287

DomainStartEndE-ValueType
low complexity region 12 30 N/A INTRINSIC
BTB 31 132 1.76e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000229290
Predicted Effect probably benign
Transcript: ENSMUST00000229622
Predicted Effect probably benign
Transcript: ENSMUST00000230020
Predicted Effect probably benign
Transcript: ENSMUST00000230226
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to a conserved family of potassium channel tetramerization domain (KCTD)-containing proteins. The encoded protein functions in ciliogenesis by acting as a substrate adaptor for the cullin3-based ubiquitin-conjugating enzyme E3 ligase, and targets trichoplein, a keratin-binding protein, for degradation via polyubiquitinylation. A mutation in this gene is associated with autosomal dominant myoclonic dystonia 26. [provided by RefSeq, Nov 2016]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Amigo2 T C 15: 97,143,166 (GRCm39) T419A probably damaging Het
Baiap2l1 A C 5: 144,217,691 (GRCm39) I298M possibly damaging Het
BC005624 G T 2: 30,863,748 (GRCm39) A245D probably benign Het
Cdh23 T A 10: 60,150,390 (GRCm39) I2527F probably damaging Het
Celsr1 T C 15: 85,915,615 (GRCm39) H786R possibly damaging Het
Cerkl A G 2: 79,168,922 (GRCm39) V427A possibly damaging Het
Cfap43 G T 19: 47,885,765 (GRCm39) C283* probably null Het
Chfr G A 5: 110,302,803 (GRCm39) A455T probably benign Het
Cldn13 T A 5: 134,943,850 (GRCm39) I112F possibly damaging Het
Cyb5rl T A 4: 106,925,875 (GRCm39) V19E probably benign Het
Dcp1a A G 14: 30,244,883 (GRCm39) T570A possibly damaging Het
Dlgap2 T A 8: 14,828,295 (GRCm39) C568S probably benign Het
Ecm2 T C 13: 49,671,859 (GRCm39) L120P probably damaging Het
Gpr156 T C 16: 37,812,416 (GRCm39) S251P probably damaging Het
Gpr182 T C 10: 127,585,790 (GRCm39) N387S probably benign Het
Grid1 T C 14: 35,291,595 (GRCm39) V834A possibly damaging Het
Igkv8-34 T C 6: 70,021,337 (GRCm39) S42G probably benign Het
Lrrc19 T A 4: 94,527,587 (GRCm39) D208V probably benign Het
Lrrc9 C T 12: 72,528,317 (GRCm39) T872I probably benign Het
Macf1 T C 4: 123,279,245 (GRCm39) probably null Het
Mrpl13 A G 15: 55,420,679 (GRCm39) M1T probably null Het
Ncapg C T 5: 45,831,805 (GRCm39) T217I probably damaging Het
Nim1k G A 13: 120,174,022 (GRCm39) P291S probably damaging Het
Or8c11 G A 9: 38,289,912 (GRCm39) G239D probably damaging Het
Or8k31-ps1 A T 2: 86,356,415 (GRCm39) Y35* probably null Het
Padi6 T C 4: 140,464,687 (GRCm39) M181V probably damaging Het
Pax7 T A 4: 139,557,514 (GRCm39) I86F probably damaging Het
Pbk T A 14: 66,054,680 (GRCm39) Y271N probably benign Het
Rabgap1 C T 2: 37,385,710 (GRCm39) P492L probably benign Het
Rhno1 G T 6: 128,334,728 (GRCm39) D198E probably damaging Het
Scn2a A C 2: 65,514,191 (GRCm39) I292L probably benign Het
Slc40a1 T C 1: 45,950,439 (GRCm39) S338G probably damaging Het
Slc45a3 A G 1: 131,905,928 (GRCm39) Y317C probably damaging Het
Stard9 T A 2: 120,532,270 (GRCm39) S2842R probably benign Het
Tle2 C T 10: 81,413,518 (GRCm39) T119I probably damaging Het
Ttn C T 2: 76,553,938 (GRCm39) V30922I possibly damaging Het
Usp33 C T 3: 152,080,297 (GRCm39) P476L probably damaging Het
Wdr38 T C 2: 38,889,361 (GRCm39) Y51H probably damaging Het
Other mutations in Kctd17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02079:Kctd17 APN 15 78,314,356 (GRCm39) splice site probably benign
IGL02209:Kctd17 APN 15 78,319,792 (GRCm39) missense probably damaging 1.00
IGL03132:Kctd17 APN 15 78,319,887 (GRCm39) missense probably damaging 1.00
R4676:Kctd17 UTSW 15 78,319,959 (GRCm39) unclassified probably benign
R4793:Kctd17 UTSW 15 78,317,224 (GRCm39) missense probably damaging 1.00
R5428:Kctd17 UTSW 15 78,312,982 (GRCm39) missense probably damaging 1.00
R5590:Kctd17 UTSW 15 78,321,502 (GRCm39) unclassified probably benign
R5779:Kctd17 UTSW 15 78,321,333 (GRCm39) unclassified probably benign
R6249:Kctd17 UTSW 15 78,314,239 (GRCm39) splice site probably null
R6911:Kctd17 UTSW 15 78,318,206 (GRCm39) missense probably damaging 1.00
R7266:Kctd17 UTSW 15 78,317,214 (GRCm39) missense probably damaging 1.00
R7324:Kctd17 UTSW 15 78,319,842 (GRCm39) missense probably damaging 1.00
R7706:Kctd17 UTSW 15 78,321,113 (GRCm39) unclassified probably benign
R7707:Kctd17 UTSW 15 78,321,113 (GRCm39) unclassified probably benign
R7967:Kctd17 UTSW 15 78,321,113 (GRCm39) unclassified probably benign
R7968:Kctd17 UTSW 15 78,321,113 (GRCm39) unclassified probably benign
R7970:Kctd17 UTSW 15 78,321,113 (GRCm39) unclassified probably benign
R7972:Kctd17 UTSW 15 78,321,113 (GRCm39) unclassified probably benign
R7973:Kctd17 UTSW 15 78,321,113 (GRCm39) unclassified probably benign
R8097:Kctd17 UTSW 15 78,321,113 (GRCm39) unclassified probably benign
R8098:Kctd17 UTSW 15 78,321,113 (GRCm39) unclassified probably benign
R8099:Kctd17 UTSW 15 78,321,113 (GRCm39) unclassified probably benign
R8100:Kctd17 UTSW 15 78,321,113 (GRCm39) unclassified probably benign
R9025:Kctd17 UTSW 15 78,314,282 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAAGACCCACCAACTGCTTTG -3'
(R):5'- TAGCGGGATCCTGAGATGACAG -3'

Sequencing Primer
(F):5'- AGAGGTCCCTTTCATCCTG -3'
(R):5'- TGAGCTAACCCTGGTGGC -3'
Posted On 2020-09-02