Incidental Mutation 'R0070:Pkd2'
ID64450
Institutional Source Beutler Lab
Gene Symbol Pkd2
Ensembl Gene ENSMUSG00000034462
Gene Namepolycystic kidney disease 2
SynonymsC030034P18Rik, TRPP2, polycystin-2, PC2
MMRRC Submission 038361-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0070 (G1)
Quality Score108
Status Validated
Chromosome5
Chromosomal Location104459450-104505819 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 104466990 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 233 (C233R)
Ref Sequence ENSEMBL: ENSMUSP00000084041 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086831]
Predicted Effect probably damaging
Transcript: ENSMUST00000086831
AA Change: C233R

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000084041
Gene: ENSMUSG00000034462
AA Change: C233R

DomainStartEndE-ValueType
low complexity region 25 43 N/A INTRINSIC
low complexity region 58 79 N/A INTRINSIC
low complexity region 93 115 N/A INTRINSIC
low complexity region 119 138 N/A INTRINSIC
transmembrane domain 225 247 N/A INTRINSIC
Pfam:PKD_channel 265 685 1.3e-171 PFAM
Pfam:Ion_trans 454 690 2.6e-25 PFAM
coiled coil region 765 794 N/A INTRINSIC
PDB:3HRN|A 834 893 8e-31 PDB
low complexity region 900 915 N/A INTRINSIC
low complexity region 949 963 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130931
Meta Mutation Damage Score 0.8917 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 96.1%
Validation Efficiency 97% (68/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the polycystin protein family. The encoded protein is a multi-pass membrane protein that functions as a calcium permeable cation channel, and is involved in calcium transport and calcium signaling in renal epithelial cells. This protein interacts with polycystin 1, and they may be partners in a common signaling cascade involved in tubular morphogenesis. Mutations in this gene are associated with autosomal dominant polycystic kidney disease type 2. [provided by RefSeq, Mar 2011]
PHENOTYPE: Homozygotes for targeted null mutations exhibit defects in cardiac septation, kidney and pancreatic cysts, impaired left-right axis determination, and late-gestation lethality. Heterozygotes show kidney and liver lesions and have reduced longevity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgre4 T C 17: 55,802,154 I387T probably damaging Het
Alpi A G 1: 87,101,159 probably benign Het
Ankfn1 A T 11: 89,392,302 L173Q probably damaging Het
Atp2a1 T C 7: 126,447,452 E892G probably benign Het
AU018091 T C 7: 3,158,898 probably null Het
Capn12 T C 7: 28,889,126 probably benign Het
Capn2 C A 1: 182,473,869 probably benign Het
Cd79b A G 11: 106,311,918 probably benign Het
Cdh7 C T 1: 110,098,372 A446V probably benign Het
Ciapin1 T C 8: 94,825,219 N246S possibly damaging Het
Cmip T A 8: 117,426,554 I270N probably damaging Het
Cyp2d40 A G 15: 82,760,774 V225A unknown Het
Dnah9 A G 11: 66,160,040 V142A probably benign Het
Fam126a T C 5: 23,964,999 S451G probably damaging Het
Flt3 A G 5: 147,372,726 probably benign Het
Gm10238 A G 15: 75,237,585 noncoding transcript Het
Gm4787 T A 12: 81,379,066 D106V probably damaging Het
Hipk2 G A 6: 38,818,984 R117* probably null Het
Ifna11 A G 4: 88,820,275 D106G possibly damaging Het
Igkv1-115 G A 6: 68,161,418 V2I probably benign Het
Itga6 T C 2: 71,826,716 probably benign Het
Kcnj6 C A 16: 94,941,197 K5N probably benign Het
Kcnt1 T C 2: 25,892,362 V191A probably benign Het
Lcorl G A 5: 45,733,701 R437C probably damaging Het
Man2a1 G A 17: 64,659,079 probably null Het
Map3k14 T A 11: 103,239,554 probably null Het
Mtch1 T A 17: 29,340,059 probably benign Het
Myo1c A G 11: 75,660,250 N217S probably benign Het
Olfr132 A G 17: 38,130,889 L101P probably damaging Het
Olfr1362 T C 13: 21,611,261 K236R possibly damaging Het
Orm3 A G 4: 63,356,646 T64A probably benign Het
Phf20l1 T G 15: 66,639,991 W940G probably damaging Het
Phldb1 C T 9: 44,707,904 R844H probably damaging Het
Piezo2 T C 18: 63,102,084 D814G probably damaging Het
Prkd3 A G 17: 78,954,510 Y792H probably damaging Het
Pth1r A T 9: 110,727,550 probably null Het
Pxdn T C 12: 29,982,727 L146S probably damaging Het
Rnf32 A G 5: 29,225,127 T315A probably benign Het
Rpl5 T C 5: 107,901,900 Y12H probably benign Het
Serpinh1 A T 7: 99,349,314 S36R probably damaging Het
Setx A T 2: 29,161,525 T2030S probably benign Het
Sf3a3 G A 4: 124,714,955 V21I probably benign Het
Sin3b T A 8: 72,725,582 H105Q probably damaging Het
Slitrk1 T C 14: 108,913,317 probably benign Het
Slx4 A T 16: 3,988,016 D557E possibly damaging Het
Sprr3 C T 3: 92,457,302 M78I probably benign Het
Ssmem1 A G 6: 30,519,421 E35G possibly damaging Het
Stag1 C T 9: 100,956,408 P1238S probably null Het
Stra6 C T 9: 58,152,615 probably benign Het
Tmem127 T C 2: 127,257,059 V171A probably damaging Het
Tmem150a A G 6: 72,358,759 probably null Het
Top2a C G 11: 99,015,060 probably null Het
Ttn T C 2: 76,814,427 probably null Het
Tusc3 G A 8: 39,063,267 G129R possibly damaging Het
Uspl1 A G 5: 149,209,705 Y422C probably damaging Het
Vmn2r88 A T 14: 51,414,140 T312S probably benign Het
Wdr78 A T 4: 103,059,934 I571K probably damaging Het
Zc3hav1l A T 6: 38,295,190 S215T probably damaging Het
Zfp947 T A 17: 22,146,184 T170S probably benign Het
Other mutations in Pkd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00898:Pkd2 APN 5 104483135 missense probably damaging 1.00
IGL01527:Pkd2 APN 5 104498884 splice site probably benign
IGL01805:Pkd2 APN 5 104483093 missense probably benign 0.41
IGL02146:Pkd2 APN 5 104489291 missense probably damaging 1.00
IGL02326:Pkd2 APN 5 104477075 missense probably benign 0.38
IGL02481:Pkd2 APN 5 104486770 missense probably damaging 1.00
IGL02952:Pkd2 APN 5 104480160 missense possibly damaging 0.48
IGL03026:Pkd2 APN 5 104494887 splice site probably benign
IGL03409:Pkd2 APN 5 104489349 nonsense probably null
Nephro UTSW 5 104486806 missense probably damaging 1.00
reggae UTSW 5 104477179 splice site probably null
samba UTSW 5 104477123 missense probably benign 0.01
IGL02988:Pkd2 UTSW 5 104503605 nonsense probably null
PIT1430001:Pkd2 UTSW 5 104459788 missense probably damaging 0.99
R0020:Pkd2 UTSW 5 104503516 missense probably damaging 1.00
R0020:Pkd2 UTSW 5 104503516 missense probably damaging 1.00
R0045:Pkd2 UTSW 5 104455805 unclassified probably benign
R0070:Pkd2 UTSW 5 104466990 missense probably damaging 0.99
R0315:Pkd2 UTSW 5 104459850 missense possibly damaging 0.94
R0316:Pkd2 UTSW 5 104477166 missense probably damaging 1.00
R0570:Pkd2 UTSW 5 104455605 unclassified probably benign
R1277:Pkd2 UTSW 5 104502359 missense probably damaging 0.97
R1883:Pkd2 UTSW 5 104483228 missense probably damaging 1.00
R1907:Pkd2 UTSW 5 104486806 missense probably damaging 1.00
R1937:Pkd2 UTSW 5 104478924 missense probably damaging 1.00
R2023:Pkd2 UTSW 5 104466878 splice site probably null
R2080:Pkd2 UTSW 5 104477123 missense probably benign 0.01
R2081:Pkd2 UTSW 5 104460211 missense probably benign 0.00
R2098:Pkd2 UTSW 5 104478902 missense probably damaging 1.00
R2117:Pkd2 UTSW 5 104483176 missense probably damaging 1.00
R2146:Pkd2 UTSW 5 104455590 unclassified probably benign
R2163:Pkd2 UTSW 5 104455677 unclassified probably benign
R3401:Pkd2 UTSW 5 104480327 missense possibly damaging 0.68
R3732:Pkd2 UTSW 5 104489419 splice site probably null
R3733:Pkd2 UTSW 5 104489419 splice site probably null
R4409:Pkd2 UTSW 5 104466884 splice site silent
R4582:Pkd2 UTSW 5 104502344 nonsense probably null
R5189:Pkd2 UTSW 5 104459919 missense probably benign 0.22
R5191:Pkd2 UTSW 5 104486681 missense probably benign 0.05
R5195:Pkd2 UTSW 5 104486681 missense probably benign 0.05
R5198:Pkd2 UTSW 5 104483092 missense probably benign 0.06
R5326:Pkd2 UTSW 5 104486649 splice site silent
R5406:Pkd2 UTSW 5 104480332 missense probably damaging 1.00
R5542:Pkd2 UTSW 5 104486649 splice site silent
R5543:Pkd2 UTSW 5 104489333 missense probably damaging 1.00
R5633:Pkd2 UTSW 5 104498506 missense probably damaging 0.98
R5887:Pkd2 UTSW 5 104498539 missense probably damaging 1.00
R5906:Pkd2 UTSW 5 104477179 splice site probably null
R5924:Pkd2 UTSW 5 104498558 missense probably damaging 0.99
R6361:Pkd2 UTSW 5 104486680 nonsense probably null
R6455:Pkd2 UTSW 5 104459924 missense probably benign 0.00
R6495:Pkd2 UTSW 5 104489293 missense probably damaging 1.00
R6735:Pkd2 UTSW 5 104480329 missense probably damaging 1.00
R6837:Pkd2 UTSW 5 104477043 missense probably damaging 1.00
R7192:Pkd2 UTSW 5 104486657 missense probably benign 0.00
R7477:Pkd2 UTSW 5 104483242 missense probably benign 0.19
R7560:Pkd2 UTSW 5 104480353 missense probably damaging 1.00
Z1088:Pkd2 UTSW 5 104498861 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGATGCTCCTGCTAAGTCACGCC -3'
(R):5'- AGGATCTAGCCTCCAAACCCCTTG -3'

Sequencing Primer
(F):5'- aattccgcctgcctctg -3'
(R):5'- GTATGGCAGGCTGCTCG -3'
Posted On2013-08-06