Incidental Mutation 'R0070:Uspl1'
ID64451
Institutional Source Beutler Lab
Gene Symbol Uspl1
Ensembl Gene ENSMUSG00000041264
Gene Nameubiquitin specific peptidase like 1
SynonymsE430026A01Rik
MMRRC Submission 038361-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.925) question?
Stock #R0070 (G1)
Quality Score108
Status Validated
Chromosome5
Chromosomal Location149184350-149215434 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 149209705 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 422 (Y422C)
Ref Sequence ENSEMBL: ENSMUSP00000113247 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050472] [ENSMUST00000100410] [ENSMUST00000117878] [ENSMUST00000119685] [ENSMUST00000121416] [ENSMUST00000122160] [ENSMUST00000126168]
Predicted Effect probably damaging
Transcript: ENSMUST00000050472
AA Change: Y422C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000050172
Gene: ENSMUSG00000041264
AA Change: Y422C

DomainStartEndE-ValueType
low complexity region 174 192 N/A INTRINSIC
Pfam:Peptidase_C98 213 486 7e-139 PFAM
Pfam:DUF4650 557 1087 1.9e-213 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000100410
AA Change: Y422C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097978
Gene: ENSMUSG00000041264
AA Change: Y422C

DomainStartEndE-ValueType
low complexity region 174 192 N/A INTRINSIC
Pfam:Peptidase_C98 213 486 1.4e-139 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000117878
AA Change: Y223C

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000113176
Gene: ENSMUSG00000041264
AA Change: Y223C

DomainStartEndE-ValueType
Pfam:Peptidase_C98 14 287 5.6e-140 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000119685
AA Change: Y408C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000114104
Gene: ENSMUSG00000041264
AA Change: Y408C

DomainStartEndE-ValueType
low complexity region 160 178 N/A INTRINSIC
Pfam:Peptidase_C98 199 472 6.9e-139 PFAM
Pfam:DUF4650 543 1073 1.8e-213 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000121416
AA Change: Y223C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113894
Gene: ENSMUSG00000041264
AA Change: Y223C

DomainStartEndE-ValueType
Pfam:Peptidase_C98 14 287 8.5e-139 PFAM
Pfam:DUF4650 358 888 1.5e-213 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000122160
AA Change: Y422C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113247
Gene: ENSMUSG00000041264
AA Change: Y422C

DomainStartEndE-ValueType
low complexity region 174 192 N/A INTRINSIC
Pfam:Peptidase_C98 214 486 2.5e-125 PFAM
Pfam:DUF4650 558 1087 1e-205 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126168
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150921
Meta Mutation Damage Score 0.3657 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 96.1%
Validation Efficiency 97% (68/70)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgre4 T C 17: 55,802,154 I387T probably damaging Het
Alpi A G 1: 87,101,159 probably benign Het
Ankfn1 A T 11: 89,392,302 L173Q probably damaging Het
Atp2a1 T C 7: 126,447,452 E892G probably benign Het
AU018091 T C 7: 3,158,898 probably null Het
Capn12 T C 7: 28,889,126 probably benign Het
Capn2 C A 1: 182,473,869 probably benign Het
Cd79b A G 11: 106,311,918 probably benign Het
Cdh7 C T 1: 110,098,372 A446V probably benign Het
Ciapin1 T C 8: 94,825,219 N246S possibly damaging Het
Cmip T A 8: 117,426,554 I270N probably damaging Het
Cyp2d40 A G 15: 82,760,774 V225A unknown Het
Dnah9 A G 11: 66,160,040 V142A probably benign Het
Fam126a T C 5: 23,964,999 S451G probably damaging Het
Flt3 A G 5: 147,372,726 probably benign Het
Gm10238 A G 15: 75,237,585 noncoding transcript Het
Gm4787 T A 12: 81,379,066 D106V probably damaging Het
Hipk2 G A 6: 38,818,984 R117* probably null Het
Ifna11 A G 4: 88,820,275 D106G possibly damaging Het
Igkv1-115 G A 6: 68,161,418 V2I probably benign Het
Itga6 T C 2: 71,826,716 probably benign Het
Kcnj6 C A 16: 94,941,197 K5N probably benign Het
Kcnt1 T C 2: 25,892,362 V191A probably benign Het
Lcorl G A 5: 45,733,701 R437C probably damaging Het
Man2a1 G A 17: 64,659,079 probably null Het
Map3k14 T A 11: 103,239,554 probably null Het
Mtch1 T A 17: 29,340,059 probably benign Het
Myo1c A G 11: 75,660,250 N217S probably benign Het
Olfr132 A G 17: 38,130,889 L101P probably damaging Het
Olfr1362 T C 13: 21,611,261 K236R possibly damaging Het
Orm3 A G 4: 63,356,646 T64A probably benign Het
Phf20l1 T G 15: 66,639,991 W940G probably damaging Het
Phldb1 C T 9: 44,707,904 R844H probably damaging Het
Piezo2 T C 18: 63,102,084 D814G probably damaging Het
Pkd2 T C 5: 104,466,990 C233R probably damaging Het
Prkd3 A G 17: 78,954,510 Y792H probably damaging Het
Pth1r A T 9: 110,727,550 probably null Het
Pxdn T C 12: 29,982,727 L146S probably damaging Het
Rnf32 A G 5: 29,225,127 T315A probably benign Het
Rpl5 T C 5: 107,901,900 Y12H probably benign Het
Serpinh1 A T 7: 99,349,314 S36R probably damaging Het
Setx A T 2: 29,161,525 T2030S probably benign Het
Sf3a3 G A 4: 124,714,955 V21I probably benign Het
Sin3b T A 8: 72,725,582 H105Q probably damaging Het
Slitrk1 T C 14: 108,913,317 probably benign Het
Slx4 A T 16: 3,988,016 D557E possibly damaging Het
Sprr3 C T 3: 92,457,302 M78I probably benign Het
Ssmem1 A G 6: 30,519,421 E35G possibly damaging Het
Stag1 C T 9: 100,956,408 P1238S probably null Het
Stra6 C T 9: 58,152,615 probably benign Het
Tmem127 T C 2: 127,257,059 V171A probably damaging Het
Tmem150a A G 6: 72,358,759 probably null Het
Top2a C G 11: 99,015,060 probably null Het
Ttn T C 2: 76,814,427 probably null Het
Tusc3 G A 8: 39,063,267 G129R possibly damaging Het
Vmn2r88 A T 14: 51,414,140 T312S probably benign Het
Wdr78 A T 4: 103,059,934 I571K probably damaging Het
Zc3hav1l A T 6: 38,295,190 S215T probably damaging Het
Zfp947 T A 17: 22,146,184 T170S probably benign Het
Other mutations in Uspl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00478:Uspl1 APN 5 149215214 missense possibly damaging 0.95
IGL00571:Uspl1 APN 5 149188360 missense probably damaging 0.99
IGL01134:Uspl1 APN 5 149204293 missense probably damaging 1.00
IGL02222:Uspl1 APN 5 149194044 missense probably benign 0.25
IGL02383:Uspl1 APN 5 149213402 missense probably damaging 0.98
IGL02538:Uspl1 APN 5 149188459 missense probably damaging 1.00
IGL02546:Uspl1 APN 5 149204304 missense possibly damaging 0.95
IGL02585:Uspl1 APN 5 149214062 nonsense probably null
IGL02971:Uspl1 APN 5 149188346 missense possibly damaging 0.84
R0020:Uspl1 UTSW 5 149209779 missense probably damaging 1.00
R0142:Uspl1 UTSW 5 149188349 missense possibly damaging 0.68
R0433:Uspl1 UTSW 5 149214815 missense probably damaging 1.00
R0554:Uspl1 UTSW 5 149187834 missense probably damaging 1.00
R0612:Uspl1 UTSW 5 149214957 missense probably damaging 1.00
R1195:Uspl1 UTSW 5 149194321 missense probably benign 0.24
R1195:Uspl1 UTSW 5 149194321 missense probably benign 0.24
R1195:Uspl1 UTSW 5 149194321 missense probably benign 0.24
R1465:Uspl1 UTSW 5 149214032 missense probably benign 0.12
R1465:Uspl1 UTSW 5 149214032 missense probably benign 0.12
R1623:Uspl1 UTSW 5 149215199 missense probably damaging 1.00
R1737:Uspl1 UTSW 5 149201858 missense probably damaging 1.00
R1793:Uspl1 UTSW 5 149213436 missense probably damaging 1.00
R1823:Uspl1 UTSW 5 149214414 missense probably benign 0.25
R2088:Uspl1 UTSW 5 149209750 missense probably damaging 1.00
R2099:Uspl1 UTSW 5 149214758 missense probably damaging 1.00
R2497:Uspl1 UTSW 5 149187854 missense probably damaging 0.98
R2944:Uspl1 UTSW 5 149201796 missense probably damaging 1.00
R3437:Uspl1 UTSW 5 149214697 utr 3 prime probably benign
R4132:Uspl1 UTSW 5 149204349 missense probably damaging 0.99
R4458:Uspl1 UTSW 5 149214152 missense possibly damaging 0.82
R4537:Uspl1 UTSW 5 149187778 missense possibly damaging 0.66
R4623:Uspl1 UTSW 5 149214595 missense probably damaging 0.99
R4633:Uspl1 UTSW 5 149214392 missense probably damaging 1.00
R4737:Uspl1 UTSW 5 149194339 missense possibly damaging 0.86
R4743:Uspl1 UTSW 5 149209756 missense probably damaging 1.00
R5200:Uspl1 UTSW 5 149214113 missense probably benign 0.02
R5222:Uspl1 UTSW 5 149214101 missense possibly damaging 0.77
R5337:Uspl1 UTSW 5 149214746 missense probably damaging 0.99
R5496:Uspl1 UTSW 5 149209779 missense probably damaging 1.00
R5654:Uspl1 UTSW 5 149209711 missense probably damaging 1.00
R5845:Uspl1 UTSW 5 149193960 missense probably benign 0.01
R6266:Uspl1 UTSW 5 149204366 missense probably damaging 1.00
R6331:Uspl1 UTSW 5 149214287 missense probably benign 0.40
R6338:Uspl1 UTSW 5 149215034 missense probably benign 0.03
R6774:Uspl1 UTSW 5 149214094 missense probably benign 0.00
R6855:Uspl1 UTSW 5 149187845 missense probably damaging 1.00
R7131:Uspl1 UTSW 5 149193935 missense probably benign 0.00
R7152:Uspl1 UTSW 5 149187778 missense possibly damaging 0.66
R7446:Uspl1 UTSW 5 149204272 nonsense probably null
R7661:Uspl1 UTSW 5 149215017 missense probably benign 0.15
X0019:Uspl1 UTSW 5 149214267 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCCCTTTCTAATCACGGCACACAG -3'
(R):5'- TTCAGACACACATCGCAGTCAGG -3'

Sequencing Primer
(F):5'- ACTCATGCTGCACTTCGT -3'
(R):5'- GTCCAGATGAAATCTGTCTTTAAACC -3'
Posted On2013-08-06