Incidental Mutation 'R8334:Arhgef16'
ID644510
Institutional Source Beutler Lab
Gene Symbol Arhgef16
Ensembl Gene ENSMUSG00000029032
Gene NameRho guanine nucleotide exchange factor (GEF) 16
SynonymsNeuroblastoma
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8334 (G1)
Quality Score156.008
Status Not validated
Chromosome4
Chromosomal Location154278486-154301676 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 154282767 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 394 (K394*)
Ref Sequence ENSEMBL: ENSMUSP00000030898 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030898] [ENSMUST00000154895] [ENSMUST00000169623]
Predicted Effect probably null
Transcript: ENSMUST00000030898
AA Change: K394*
SMART Domains Protein: ENSMUSP00000030898
Gene: ENSMUSG00000029032
AA Change: K394*

DomainStartEndE-ValueType
low complexity region 51 72 N/A INTRINSIC
RhoGEF 292 471 5.9e-52 SMART
PH 506 626 6.46e-8 SMART
SH3 636 692 2.31e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000154895
SMART Domains Protein: ENSMUSP00000121273
Gene: ENSMUSG00000029032

DomainStartEndE-ValueType
low complexity region 51 72 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000169623
AA Change: K394*
SMART Domains Protein: ENSMUSP00000126296
Gene: ENSMUSG00000029032
AA Change: K394*

DomainStartEndE-ValueType
low complexity region 51 72 N/A INTRINSIC
RhoGEF 292 471 5.9e-52 SMART
PH 506 626 6.46e-8 SMART
SH3 636 692 2.31e-12 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (63/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Although the specific function of this protein is not known yet, it is thought to be involved in protein-protein and protein-lipid interactions. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530077C05Rik A G 9: 22,444,118 E483G probably benign Het
Abca8a A T 11: 110,068,824 S696T probably damaging Het
Abhd12 T C 2: 150,858,453 I75V probably benign Het
Adamts9 T C 6: 92,937,244 probably null Het
Ap2a1 C T 7: 44,904,711 V499I possibly damaging Het
Armc2 A G 10: 41,923,765 F699S probably damaging Het
Atat1 C T 17: 35,909,258 probably null Het
Atm A G 9: 53,522,273 S226P probably benign Het
Bcas3 A G 11: 85,576,811 T687A possibly damaging Het
Bmp2k T C 5: 97,027,894 M78T possibly damaging Het
Brinp3 T A 1: 146,902,053 L746H probably damaging Het
Capn8 G A 1: 182,611,105 probably null Het
Ccdc154 T A 17: 25,171,607 F602I probably damaging Het
Celsr3 CGGGG CGGGGG 9: 108,841,272 probably null Het
Chd3 A G 11: 69,350,796 F1504L probably damaging Het
Cpsf1 A T 15: 76,603,587 N77K probably benign Het
Crybb3 T A 5: 113,075,979 Q188L possibly damaging Het
Dnah8 T A 17: 30,769,831 H3258Q probably benign Het
Dnajb6 C T 5: 29,781,240 R269W unknown Het
Dusp9 TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG X: 73,640,611 probably benign Het
Ech1 A G 7: 28,831,823 I279V probably benign Het
Ehbp1 C A 11: 22,007,170 R1173L probably damaging Het
Ehd4 T C 2: 120,137,064 E83G probably damaging Het
Epha7 A G 4: 28,938,777 E544G probably benign Het
Esp23 A G 17: 39,073,904 V67A possibly damaging Het
Etl4 T C 2: 20,781,046 V726A probably damaging Het
Fbxo39 G A 11: 72,317,644 W274* probably null Het
Filip1l T C 16: 57,570,147 I366T probably benign Het
Gm4841 T C 18: 60,270,982 D13G probably benign Het
Gm6205 T G 5: 94,682,776 N44K probably benign Het
Gtpbp2 T A 17: 46,166,442 F411Y possibly damaging Het
Kmt5b G T 19: 3,814,795 V620L probably benign Het
Lrrc24 T C 15: 76,716,000 Q313R probably benign Het
Lsm1 A G 8: 25,802,019 E108G probably benign Het
Macf1 T C 4: 123,432,108 K5201E possibly damaging Het
Mki67 G T 7: 135,696,516 T2263K probably damaging Het
Mroh1 G A 15: 76,446,556 G1156S probably benign Het
Ncor1 A T 11: 62,383,244 M190K probably damaging Het
Nsmce3 A G 7: 64,872,719 V67A probably damaging Het
Nuggc T C 14: 65,645,029 V741A probably benign Het
Olfm3 G T 3: 115,122,557 L379F probably damaging Het
Olfr1274-ps T C 2: 90,400,933 S91P probably benign Het
Olfr935 T A 9: 38,994,593 I281F probably benign Het
Pcdhb13 A G 18: 37,444,800 T744A probably damaging Het
Plek T C 11: 16,983,220 T298A probably benign Het
Pou5f2 A G 13: 78,025,273 I111M probably benign Het
Pou6f2 C T 13: 18,125,406 R556H probably damaging Het
Rcor1 G A 12: 111,093,095 A148T Het
Rnh1 A G 7: 141,168,631 V11A probably benign Het
Rrnad1 C T 3: 87,927,749 V31I possibly damaging Het
Slc35f1 T C 10: 53,108,148 F335L possibly damaging Het
Srrm2 T C 17: 23,808,356 V22A unknown Het
St7 A T 6: 17,934,221 H534L probably damaging Het
Swi5 T A 2: 32,280,451 probably benign Het
Syf2 T A 4: 134,931,275 H40Q probably benign Het
Tgtp2 G A 11: 49,058,894 L284F probably benign Het
Tnn C T 1: 160,118,483 G922R probably damaging Het
Trbc1 A C 6: 41,539,112 probably benign Het
Trim33 A T 3: 103,353,829 T1115S probably benign Het
Ttc22 C A 4: 106,638,918 probably null Het
Ttn C T 2: 76,808,030 A13969T probably damaging Het
Tuba4a T C 1: 75,217,301 D74G probably benign Het
Ube3c T A 5: 29,590,884 D90E probably benign Het
Ubr7 T C 12: 102,758,138 V37A probably damaging Het
Vmn2r28 A C 7: 5,484,060 C535G probably damaging Het
Wdr36 A G 18: 32,859,293 T628A possibly damaging Het
Whrn C T 4: 63,494,810 V142M probably damaging Het
Wnk2 A T 13: 49,050,482 probably null Het
Xkr7 C T 2: 153,054,963 T579I probably damaging Het
Other mutations in Arhgef16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01107:Arhgef16 APN 4 154280244 missense probably benign 0.01
IGL02422:Arhgef16 APN 4 154287065 nonsense probably null
IGL02801:Arhgef16 APN 4 154291507 missense probably damaging 0.99
IGL02928:Arhgef16 APN 4 154282893 missense probably benign 0.00
R0518:Arhgef16 UTSW 4 154291034 missense probably damaging 0.99
R1148:Arhgef16 UTSW 4 154280889 missense probably benign 0.05
R1148:Arhgef16 UTSW 4 154280889 missense probably benign 0.05
R1576:Arhgef16 UTSW 4 154291312 missense probably damaging 1.00
R1778:Arhgef16 UTSW 4 154287986 missense probably benign 0.17
R1853:Arhgef16 UTSW 4 154291106 missense probably benign 0.14
R1912:Arhgef16 UTSW 4 154280323 splice site probably null
R2269:Arhgef16 UTSW 4 154285033 missense probably damaging 0.98
R4437:Arhgef16 UTSW 4 154279696 critical splice donor site probably null
R4690:Arhgef16 UTSW 4 154287963 splice site probably null
R5174:Arhgef16 UTSW 4 154282047 missense probably damaging 1.00
R5566:Arhgef16 UTSW 4 154285648 missense probably benign 0.01
R6348:Arhgef16 UTSW 4 154287083 missense probably benign 0.18
R7264:Arhgef16 UTSW 4 154280930 missense probably damaging 1.00
R7469:Arhgef16 UTSW 4 154291306 missense probably damaging 1.00
R7626:Arhgef16 UTSW 4 154282882 missense possibly damaging 0.89
R7651:Arhgef16 UTSW 4 154291067 missense probably damaging 1.00
R7684:Arhgef16 UTSW 4 154281828 missense possibly damaging 0.62
R7759:Arhgef16 UTSW 4 154286975 missense probably benign 0.00
Z1177:Arhgef16 UTSW 4 154281453 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCTGCATGGGGAGAATCAG -3'
(R):5'- TGTCAAAAGTGAGCCTTTGC -3'

Sequencing Primer
(F):5'- AGAGATCATGGGCAGGCC -3'
(R):5'- TTGCTTCCCCACCCACG -3'
Posted On2020-09-02