Incidental Mutation 'R8334:Ap2a1'
ID644520
Institutional Source Beutler Lab
Gene Symbol Ap2a1
Ensembl Gene ENSMUSG00000060279
Gene Nameadaptor-related protein complex 2, alpha 1 subunit
SynonymsAdtaa
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.543) question?
Stock #R8334 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location44900373-44929496 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 44904711 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 499 (V499I)
Ref Sequence ENSEMBL: ENSMUSP00000127842 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071207] [ENSMUST00000085399] [ENSMUST00000107857] [ENSMUST00000166972] [ENSMUST00000167930] [ENSMUST00000207485] [ENSMUST00000208179] [ENSMUST00000209039]
Predicted Effect probably benign
Transcript: ENSMUST00000071207
SMART Domains Protein: ENSMUSP00000071194
Gene: ENSMUSG00000011658

DomainStartEndE-ValueType
low complexity region 234 259 N/A INTRINSIC
low complexity region 292 310 N/A INTRINSIC
low complexity region 382 391 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000085399
AA Change: V499I

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000082519
Gene: ENSMUSG00000060279
AA Change: V499I

DomainStartEndE-ValueType
Pfam:Adaptin_N 29 591 7.5e-150 PFAM
low complexity region 646 657 N/A INTRINSIC
low complexity region 665 675 N/A INTRINSIC
low complexity region 699 741 N/A INTRINSIC
Alpha_adaptinC2 745 858 4.49e-23 SMART
Pfam:Alpha_adaptin_C 864 972 9.4e-46 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000107857
AA Change: V499I

PolyPhen 2 Score 0.616 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000103489
Gene: ENSMUSG00000060279
AA Change: V499I

DomainStartEndE-ValueType
Pfam:Adaptin_N 29 591 7e-150 PFAM
low complexity region 646 657 N/A INTRINSIC
low complexity region 665 675 N/A INTRINSIC
low complexity region 706 719 N/A INTRINSIC
Alpha_adaptinC2 723 836 4.49e-23 SMART
Pfam:Alpha_adaptin_C 842 950 9.1e-46 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000166972
AA Change: V499I

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000127842
Gene: ENSMUSG00000060279
AA Change: V499I

DomainStartEndE-ValueType
Pfam:Adaptin_N 29 591 2e-149 PFAM
low complexity region 646 657 N/A INTRINSIC
low complexity region 665 675 N/A INTRINSIC
low complexity region 699 741 N/A INTRINSIC
Alpha_adaptinC2 745 858 4.49e-23 SMART
Pfam:Alpha_adaptin_C 864 972 5.4e-46 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000167930
AA Change: V499I

PolyPhen 2 Score 0.616 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000127497
Gene: ENSMUSG00000060279
AA Change: V499I

DomainStartEndE-ValueType
Pfam:Adaptin_N 29 591 7e-150 PFAM
low complexity region 646 657 N/A INTRINSIC
low complexity region 665 675 N/A INTRINSIC
low complexity region 706 719 N/A INTRINSIC
Alpha_adaptinC2 723 836 4.49e-23 SMART
Pfam:Alpha_adaptin_C 842 950 9.1e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000207485
Predicted Effect probably benign
Transcript: ENSMUST00000207814
Predicted Effect probably benign
Transcript: ENSMUST00000208179
Predicted Effect probably benign
Transcript: ENSMUST00000208472
Predicted Effect probably benign
Transcript: ENSMUST00000209039
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (63/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha 1 adaptin subunit of the adaptor protein 2 (AP-2) complex found in clathrin coated vesicles. The AP-2 complex is a heterotetramer consisting of two large adaptins (alpha or beta), a medium adaptin (mu), and a small adaptin (sigma). The complex is part of the protein coat on the cytoplasmic face of coated vesicles which links clathrin to receptors in vesicles. Alternative splicing of this gene results in two transcript variants encoding two different isoforms. A third transcript variant has been described, but its full length nature has not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530077C05Rik A G 9: 22,444,118 E483G probably benign Het
Abca8a A T 11: 110,068,824 S696T probably damaging Het
Abhd12 T C 2: 150,858,453 I75V probably benign Het
Adamts9 T C 6: 92,937,244 probably null Het
Arhgef16 T A 4: 154,282,767 K394* probably null Het
Armc2 A G 10: 41,923,765 F699S probably damaging Het
Atat1 C T 17: 35,909,258 probably null Het
Atm A G 9: 53,522,273 S226P probably benign Het
Bcas3 A G 11: 85,576,811 T687A possibly damaging Het
Bmp2k T C 5: 97,027,894 M78T possibly damaging Het
Brinp3 T A 1: 146,902,053 L746H probably damaging Het
Capn8 G A 1: 182,611,105 probably null Het
Ccdc154 T A 17: 25,171,607 F602I probably damaging Het
Celsr3 CGGGG CGGGGG 9: 108,841,272 probably null Het
Chd3 A G 11: 69,350,796 F1504L probably damaging Het
Cpsf1 A T 15: 76,603,587 N77K probably benign Het
Crybb3 T A 5: 113,075,979 Q188L possibly damaging Het
Dnah8 T A 17: 30,769,831 H3258Q probably benign Het
Dnajb6 C T 5: 29,781,240 R269W unknown Het
Dusp9 TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG X: 73,640,611 probably benign Het
Ech1 A G 7: 28,831,823 I279V probably benign Het
Ehbp1 C A 11: 22,007,170 R1173L probably damaging Het
Ehd4 T C 2: 120,137,064 E83G probably damaging Het
Epha7 A G 4: 28,938,777 E544G probably benign Het
Esp23 A G 17: 39,073,904 V67A possibly damaging Het
Etl4 T C 2: 20,781,046 V726A probably damaging Het
Fbxo39 G A 11: 72,317,644 W274* probably null Het
Filip1l T C 16: 57,570,147 I366T probably benign Het
Gm4841 T C 18: 60,270,982 D13G probably benign Het
Gm6205 T G 5: 94,682,776 N44K probably benign Het
Gtpbp2 T A 17: 46,166,442 F411Y possibly damaging Het
Kmt5b G T 19: 3,814,795 V620L probably benign Het
Lrrc24 T C 15: 76,716,000 Q313R probably benign Het
Lsm1 A G 8: 25,802,019 E108G probably benign Het
Macf1 T C 4: 123,432,108 K5201E possibly damaging Het
Mki67 G T 7: 135,696,516 T2263K probably damaging Het
Mroh1 G A 15: 76,446,556 G1156S probably benign Het
Ncor1 A T 11: 62,383,244 M190K probably damaging Het
Nsmce3 A G 7: 64,872,719 V67A probably damaging Het
Nuggc T C 14: 65,645,029 V741A probably benign Het
Olfm3 G T 3: 115,122,557 L379F probably damaging Het
Olfr1274-ps T C 2: 90,400,933 S91P probably benign Het
Olfr935 T A 9: 38,994,593 I281F probably benign Het
Pcdhb13 A G 18: 37,444,800 T744A probably damaging Het
Plek T C 11: 16,983,220 T298A probably benign Het
Pou5f2 A G 13: 78,025,273 I111M probably benign Het
Pou6f2 C T 13: 18,125,406 R556H probably damaging Het
Rcor1 G A 12: 111,093,095 A148T Het
Rnh1 A G 7: 141,168,631 V11A probably benign Het
Rrnad1 C T 3: 87,927,749 V31I possibly damaging Het
Slc35f1 T C 10: 53,108,148 F335L possibly damaging Het
Srrm2 T C 17: 23,808,356 V22A unknown Het
St7 A T 6: 17,934,221 H534L probably damaging Het
Swi5 T A 2: 32,280,451 probably benign Het
Syf2 T A 4: 134,931,275 H40Q probably benign Het
Tgtp2 G A 11: 49,058,894 L284F probably benign Het
Tnn C T 1: 160,118,483 G922R probably damaging Het
Trbc1 A C 6: 41,539,112 probably benign Het
Trim33 A T 3: 103,353,829 T1115S probably benign Het
Ttc22 C A 4: 106,638,918 probably null Het
Ttn C T 2: 76,808,030 A13969T probably damaging Het
Tuba4a T C 1: 75,217,301 D74G probably benign Het
Ube3c T A 5: 29,590,884 D90E probably benign Het
Ubr7 T C 12: 102,758,138 V37A probably damaging Het
Vmn2r28 A C 7: 5,484,060 C535G probably damaging Het
Wdr36 A G 18: 32,859,293 T628A possibly damaging Het
Whrn C T 4: 63,494,810 V142M probably damaging Het
Wnk2 A T 13: 49,050,482 probably null Het
Xkr7 C T 2: 153,054,963 T579I probably damaging Het
Other mutations in Ap2a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Ap2a1 APN 7 44905768 missense probably damaging 1.00
IGL01315:Ap2a1 APN 7 44916289 missense possibly damaging 0.47
IGL01324:Ap2a1 APN 7 44905696 missense probably damaging 1.00
IGL02545:Ap2a1 APN 7 44906426 missense probably damaging 1.00
IGL03067:Ap2a1 APN 7 44903511 missense probably benign
IGL03172:Ap2a1 APN 7 44904055 missense probably benign 0.00
disaffected UTSW 7 44916164 missense probably damaging 1.00
R0233:Ap2a1 UTSW 7 44915973 missense probably damaging 1.00
R0233:Ap2a1 UTSW 7 44915973 missense probably damaging 1.00
R0546:Ap2a1 UTSW 7 44904708 missense probably damaging 0.97
R1103:Ap2a1 UTSW 7 44904169 unclassified probably benign
R1566:Ap2a1 UTSW 7 44903480 missense probably benign 0.02
R1682:Ap2a1 UTSW 7 44915938 missense probably benign 0.14
R1745:Ap2a1 UTSW 7 44906945 missense probably damaging 1.00
R1777:Ap2a1 UTSW 7 44904152 missense probably damaging 1.00
R4627:Ap2a1 UTSW 7 44904419 missense probably damaging 1.00
R4669:Ap2a1 UTSW 7 44902919 unclassified probably benign
R4776:Ap2a1 UTSW 7 44901546 unclassified probably benign
R4909:Ap2a1 UTSW 7 44906381 missense probably damaging 1.00
R5040:Ap2a1 UTSW 7 44905804 missense possibly damaging 0.78
R5278:Ap2a1 UTSW 7 44902779 missense probably benign 0.00
R5310:Ap2a1 UTSW 7 44906065 splice site probably null
R5517:Ap2a1 UTSW 7 44906981 missense possibly damaging 0.93
R5635:Ap2a1 UTSW 7 44923901 intron probably benign
R6002:Ap2a1 UTSW 7 44904395 splice site probably null
R6083:Ap2a1 UTSW 7 44907751 missense probably damaging 1.00
R6185:Ap2a1 UTSW 7 44916170 missense probably damaging 1.00
R6430:Ap2a1 UTSW 7 44903829 missense probably benign
R6491:Ap2a1 UTSW 7 44916164 missense probably damaging 1.00
R7058:Ap2a1 UTSW 7 44900791 missense probably damaging 1.00
R7180:Ap2a1 UTSW 7 44923804 splice site probably null
R7490:Ap2a1 UTSW 7 44902789 missense probably benign 0.03
R7765:Ap2a1 UTSW 7 44909736 missense probably damaging 1.00
R7831:Ap2a1 UTSW 7 44901012 missense probably damaging 1.00
R8237:Ap2a1 UTSW 7 44900796 missense probably damaging 1.00
R8540:Ap2a1 UTSW 7 44904326 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACAGGTGGAACTTGGAGTGC -3'
(R):5'- AGTCAGGCTAGTCACCTCAC -3'

Sequencing Primer
(F):5'- TGTCCTCATGCAGGGGTAAC -3'
(R):5'- GTCAGGCTAGTCACCTCACAACTC -3'
Posted On2020-09-02