Incidental Mutation 'R8334:Slc35f1'
ID644530
Institutional Source Beutler Lab
Gene Symbol Slc35f1
Ensembl Gene ENSMUSG00000038602
Gene Namesolute carrier family 35, member F1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8334 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location52690533-53111622 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 53108148 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 335 (F335L)
Ref Sequence ENSEMBL: ENSMUSP00000101113 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105473]
Predicted Effect possibly damaging
Transcript: ENSMUST00000105473
AA Change: F335L

PolyPhen 2 Score 0.840 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000101113
Gene: ENSMUSG00000038602
AA Change: F335L

DomainStartEndE-ValueType
low complexity region 3 20 N/A INTRINSIC
Pfam:SLC35F 56 355 1.4e-151 PFAM
Pfam:CRT-like 66 315 2.3e-13 PFAM
Pfam:EamA 217 355 1.7e-9 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (63/64)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit no detectable phenotypic abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530077C05Rik A G 9: 22,444,118 E483G probably benign Het
Abca8a A T 11: 110,068,824 S696T probably damaging Het
Abhd12 T C 2: 150,858,453 I75V probably benign Het
Adamts9 T C 6: 92,937,244 probably null Het
Ap2a1 C T 7: 44,904,711 V499I possibly damaging Het
Arhgef16 T A 4: 154,282,767 K394* probably null Het
Armc2 A G 10: 41,923,765 F699S probably damaging Het
Atat1 C T 17: 35,909,258 probably null Het
Atm A G 9: 53,522,273 S226P probably benign Het
Bcas3 A G 11: 85,576,811 T687A possibly damaging Het
Bmp2k T C 5: 97,027,894 M78T possibly damaging Het
Brinp3 T A 1: 146,902,053 L746H probably damaging Het
Capn8 G A 1: 182,611,105 probably null Het
Ccdc154 T A 17: 25,171,607 F602I probably damaging Het
Celsr3 CGGGG CGGGGG 9: 108,841,272 probably null Het
Chd3 A G 11: 69,350,796 F1504L probably damaging Het
Cpsf1 A T 15: 76,603,587 N77K probably benign Het
Crybb3 T A 5: 113,075,979 Q188L possibly damaging Het
Dnah8 T A 17: 30,769,831 H3258Q probably benign Het
Dnajb6 C T 5: 29,781,240 R269W unknown Het
Dusp9 TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG X: 73,640,611 probably benign Het
Ech1 A G 7: 28,831,823 I279V probably benign Het
Ehbp1 C A 11: 22,007,170 R1173L probably damaging Het
Ehd4 T C 2: 120,137,064 E83G probably damaging Het
Epha7 A G 4: 28,938,777 E544G probably benign Het
Esp23 A G 17: 39,073,904 V67A possibly damaging Het
Etl4 T C 2: 20,781,046 V726A probably damaging Het
Fbxo39 G A 11: 72,317,644 W274* probably null Het
Filip1l T C 16: 57,570,147 I366T probably benign Het
Gm4841 T C 18: 60,270,982 D13G probably benign Het
Gm6205 T G 5: 94,682,776 N44K probably benign Het
Gtpbp2 T A 17: 46,166,442 F411Y possibly damaging Het
Kmt5b G T 19: 3,814,795 V620L probably benign Het
Lrrc24 T C 15: 76,716,000 Q313R probably benign Het
Lsm1 A G 8: 25,802,019 E108G probably benign Het
Macf1 T C 4: 123,432,108 K5201E possibly damaging Het
Mki67 G T 7: 135,696,516 T2263K probably damaging Het
Mroh1 G A 15: 76,446,556 G1156S probably benign Het
Ncor1 A T 11: 62,383,244 M190K probably damaging Het
Nsmce3 A G 7: 64,872,719 V67A probably damaging Het
Nuggc T C 14: 65,645,029 V741A probably benign Het
Olfm3 G T 3: 115,122,557 L379F probably damaging Het
Olfr1274-ps T C 2: 90,400,933 S91P probably benign Het
Olfr935 T A 9: 38,994,593 I281F probably benign Het
Pcdhb13 A G 18: 37,444,800 T744A probably damaging Het
Plek T C 11: 16,983,220 T298A probably benign Het
Pou5f2 A G 13: 78,025,273 I111M probably benign Het
Pou6f2 C T 13: 18,125,406 R556H probably damaging Het
Rcor1 G A 12: 111,093,095 A148T Het
Rnh1 A G 7: 141,168,631 V11A probably benign Het
Rrnad1 C T 3: 87,927,749 V31I possibly damaging Het
Srrm2 T C 17: 23,808,356 V22A unknown Het
St7 A T 6: 17,934,221 H534L probably damaging Het
Swi5 T A 2: 32,280,451 probably benign Het
Syf2 T A 4: 134,931,275 H40Q probably benign Het
Tgtp2 G A 11: 49,058,894 L284F probably benign Het
Tnn C T 1: 160,118,483 G922R probably damaging Het
Trbc1 A C 6: 41,539,112 probably benign Het
Trim33 A T 3: 103,353,829 T1115S probably benign Het
Ttc22 C A 4: 106,638,918 probably null Het
Ttn C T 2: 76,808,030 A13969T probably damaging Het
Tuba4a T C 1: 75,217,301 D74G probably benign Het
Ube3c T A 5: 29,590,884 D90E probably benign Het
Ubr7 T C 12: 102,758,138 V37A probably damaging Het
Vmn2r28 A C 7: 5,484,060 C535G probably damaging Het
Wdr36 A G 18: 32,859,293 T628A possibly damaging Het
Whrn C T 4: 63,494,810 V142M probably damaging Het
Wnk2 A T 13: 49,050,482 probably null Het
Xkr7 C T 2: 153,054,963 T579I probably damaging Het
Other mutations in Slc35f1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00434:Slc35f1 APN 10 53062452 missense probably damaging 1.00
IGL01073:Slc35f1 APN 10 53021960 missense probably benign 0.16
IGL01433:Slc35f1 APN 10 53073446 splice site probably benign
IGL01566:Slc35f1 APN 10 53089455 missense probably damaging 1.00
IGL02693:Slc35f1 APN 10 52933128 missense probably damaging 1.00
IGL02870:Slc35f1 APN 10 52933207 missense possibly damaging 0.82
IGL03082:Slc35f1 APN 10 52933138 missense probably benign
R0884:Slc35f1 UTSW 10 53089347 missense probably damaging 1.00
R1340:Slc35f1 UTSW 10 53089454 missense probably damaging 1.00
R1781:Slc35f1 UTSW 10 53062436 splice site probably null
R1813:Slc35f1 UTSW 10 52933195 missense probably damaging 1.00
R1908:Slc35f1 UTSW 10 53021904 missense possibly damaging 0.84
R2044:Slc35f1 UTSW 10 53089347 missense probably damaging 1.00
R2518:Slc35f1 UTSW 10 53073534 missense probably benign 0.07
R3872:Slc35f1 UTSW 10 53021910 missense possibly damaging 0.87
R3934:Slc35f1 UTSW 10 53108218 missense probably damaging 1.00
R3935:Slc35f1 UTSW 10 53108218 missense probably damaging 1.00
R3936:Slc35f1 UTSW 10 53108218 missense probably damaging 1.00
R4118:Slc35f1 UTSW 10 53089368 missense probably damaging 0.98
R4921:Slc35f1 UTSW 10 53062602 missense probably damaging 0.99
R5116:Slc35f1 UTSW 10 53021895 missense probably benign 0.39
R5378:Slc35f1 UTSW 10 52691061 missense possibly damaging 0.86
R5387:Slc35f1 UTSW 10 53108164 missense probably damaging 1.00
R5500:Slc35f1 UTSW 10 52933222 missense probably damaging 0.99
R5590:Slc35f1 UTSW 10 53108178 missense possibly damaging 0.63
R5743:Slc35f1 UTSW 10 53089450 missense probably benign 0.06
R5916:Slc35f1 UTSW 10 52933221 nonsense probably null
R6985:Slc35f1 UTSW 10 53021911 missense probably benign 0.02
R7068:Slc35f1 UTSW 10 53062500 missense probably damaging 1.00
R7295:Slc35f1 UTSW 10 53062541 missense probably benign 0.00
R7427:Slc35f1 UTSW 10 53089414 missense probably damaging 1.00
R7428:Slc35f1 UTSW 10 53089414 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCCTCTCATTAGCCACAAGG -3'
(R):5'- ACGTACATGGGGCTCTTCTTC -3'

Sequencing Primer
(F):5'- CCATCAAGAGTATCAGCTACC -3'
(R):5'- CCAGGCTGGTGTAGGTGAC -3'
Posted On2020-09-02