Incidental Mutation 'R8334:Ehbp1'
ID644532
Institutional Source Beutler Lab
Gene Symbol Ehbp1
Ensembl Gene ENSMUSG00000042302
Gene NameEH domain binding protein 1
SynonymsKIAA0903-like, Flj21950
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.468) question?
Stock #R8334 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location22005828-22342292 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 22007170 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 1173 (R1173L)
Ref Sequence ENSEMBL: ENSMUSP00000105191 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045167] [ENSMUST00000109563] [ENSMUST00000147486] [ENSMUST00000180360]
Predicted Effect probably damaging
Transcript: ENSMUST00000045167
AA Change: R1148L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000037489
Gene: ENSMUSG00000042302
AA Change: R1148L

DomainStartEndE-ValueType
Pfam:NT-C2 12 165 3.8e-32 PFAM
Blast:DUF3585 176 285 7e-6 BLAST
low complexity region 332 343 N/A INTRINSIC
low complexity region 374 392 N/A INTRINSIC
low complexity region 411 422 N/A INTRINSIC
CH 430 528 1.42e-15 SMART
Blast:CH 757 826 3e-12 BLAST
low complexity region 829 850 N/A INTRINSIC
low complexity region 883 898 N/A INTRINSIC
DUF3585 1043 1187 4.25e-61 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109563
AA Change: R1173L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105191
Gene: ENSMUSG00000042302
AA Change: R1173L

DomainStartEndE-ValueType
Pfam:NT-C2 12 165 1.3e-29 PFAM
Blast:DUF3585 176 285 7e-6 BLAST
low complexity region 357 368 N/A INTRINSIC
low complexity region 399 417 N/A INTRINSIC
low complexity region 436 447 N/A INTRINSIC
CH 455 553 1.42e-15 SMART
Blast:CH 782 851 3e-12 BLAST
low complexity region 854 875 N/A INTRINSIC
low complexity region 908 923 N/A INTRINSIC
DUF3585 1068 1212 4.25e-61 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000147486
SMART Domains Protein: ENSMUSP00000134704
Gene: ENSMUSG00000005917

DomainStartEndE-ValueType
HOX 38 100 1.21e-25 SMART
low complexity region 117 125 N/A INTRINSIC
low complexity region 133 147 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000180360
AA Change: R1148L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000136697
Gene: ENSMUSG00000042302
AA Change: R1148L

DomainStartEndE-ValueType
Pfam:NT-C2 12 165 3.8e-32 PFAM
Blast:DUF3585 176 285 7e-6 BLAST
low complexity region 332 343 N/A INTRINSIC
low complexity region 374 392 N/A INTRINSIC
low complexity region 411 422 N/A INTRINSIC
CH 430 528 1.42e-15 SMART
Blast:CH 757 826 3e-12 BLAST
low complexity region 829 850 N/A INTRINSIC
low complexity region 883 898 N/A INTRINSIC
DUF3585 1043 1187 4.25e-61 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (63/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an Eps15 homology domain binding protein. The encoded protein may play a role in endocytic trafficking. A single nucleotide polymorphism in this gene is associated with an aggressive form of prostate cancer. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Feb 2010]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530077C05Rik A G 9: 22,444,118 E483G probably benign Het
Abca8a A T 11: 110,068,824 S696T probably damaging Het
Abhd12 T C 2: 150,858,453 I75V probably benign Het
Adamts9 T C 6: 92,937,244 probably null Het
Ap2a1 C T 7: 44,904,711 V499I possibly damaging Het
Arhgef16 T A 4: 154,282,767 K394* probably null Het
Armc2 A G 10: 41,923,765 F699S probably damaging Het
Atat1 C T 17: 35,909,258 probably null Het
Atm A G 9: 53,522,273 S226P probably benign Het
Bcas3 A G 11: 85,576,811 T687A possibly damaging Het
Bmp2k T C 5: 97,027,894 M78T possibly damaging Het
Brinp3 T A 1: 146,902,053 L746H probably damaging Het
Capn8 G A 1: 182,611,105 probably null Het
Ccdc154 T A 17: 25,171,607 F602I probably damaging Het
Celsr3 CGGGG CGGGGG 9: 108,841,272 probably null Het
Chd3 A G 11: 69,350,796 F1504L probably damaging Het
Cpsf1 A T 15: 76,603,587 N77K probably benign Het
Crybb3 T A 5: 113,075,979 Q188L possibly damaging Het
Dnah8 T A 17: 30,769,831 H3258Q probably benign Het
Dnajb6 C T 5: 29,781,240 R269W unknown Het
Dusp9 TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG X: 73,640,611 probably benign Het
Ech1 A G 7: 28,831,823 I279V probably benign Het
Ehd4 T C 2: 120,137,064 E83G probably damaging Het
Epha7 A G 4: 28,938,777 E544G probably benign Het
Esp23 A G 17: 39,073,904 V67A possibly damaging Het
Etl4 T C 2: 20,781,046 V726A probably damaging Het
Fbxo39 G A 11: 72,317,644 W274* probably null Het
Filip1l T C 16: 57,570,147 I366T probably benign Het
Gm4841 T C 18: 60,270,982 D13G probably benign Het
Gm6205 T G 5: 94,682,776 N44K probably benign Het
Gtpbp2 T A 17: 46,166,442 F411Y possibly damaging Het
Kmt5b G T 19: 3,814,795 V620L probably benign Het
Lrrc24 T C 15: 76,716,000 Q313R probably benign Het
Lsm1 A G 8: 25,802,019 E108G probably benign Het
Macf1 T C 4: 123,432,108 K5201E possibly damaging Het
Mki67 G T 7: 135,696,516 T2263K probably damaging Het
Mroh1 G A 15: 76,446,556 G1156S probably benign Het
Ncor1 A T 11: 62,383,244 M190K probably damaging Het
Nsmce3 A G 7: 64,872,719 V67A probably damaging Het
Nuggc T C 14: 65,645,029 V741A probably benign Het
Olfm3 G T 3: 115,122,557 L379F probably damaging Het
Olfr1274-ps T C 2: 90,400,933 S91P probably benign Het
Olfr935 T A 9: 38,994,593 I281F probably benign Het
Pcdhb13 A G 18: 37,444,800 T744A probably damaging Het
Plek T C 11: 16,983,220 T298A probably benign Het
Pou5f2 A G 13: 78,025,273 I111M probably benign Het
Pou6f2 C T 13: 18,125,406 R556H probably damaging Het
Rcor1 G A 12: 111,093,095 A148T Het
Rnh1 A G 7: 141,168,631 V11A probably benign Het
Rrnad1 C T 3: 87,927,749 V31I possibly damaging Het
Slc35f1 T C 10: 53,108,148 F335L possibly damaging Het
Srrm2 T C 17: 23,808,356 V22A unknown Het
St7 A T 6: 17,934,221 H534L probably damaging Het
Swi5 T A 2: 32,280,451 probably benign Het
Syf2 T A 4: 134,931,275 H40Q probably benign Het
Tgtp2 G A 11: 49,058,894 L284F probably benign Het
Tnn C T 1: 160,118,483 G922R probably damaging Het
Trbc1 A C 6: 41,539,112 probably benign Het
Trim33 A T 3: 103,353,829 T1115S probably benign Het
Ttc22 C A 4: 106,638,918 probably null Het
Ttn C T 2: 76,808,030 A13969T probably damaging Het
Tuba4a T C 1: 75,217,301 D74G probably benign Het
Ube3c T A 5: 29,590,884 D90E probably benign Het
Ubr7 T C 12: 102,758,138 V37A probably damaging Het
Vmn2r28 A C 7: 5,484,060 C535G probably damaging Het
Wdr36 A G 18: 32,859,293 T628A possibly damaging Het
Whrn C T 4: 63,494,810 V142M probably damaging Het
Wnk2 A T 13: 49,050,482 probably null Het
Xkr7 C T 2: 153,054,963 T579I probably damaging Het
Other mutations in Ehbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00754:Ehbp1 APN 11 22247967 splice site probably benign
IGL00786:Ehbp1 APN 11 22100460 missense possibly damaging 0.79
IGL01308:Ehbp1 APN 11 22138022 missense probably damaging 1.00
IGL01322:Ehbp1 APN 11 22089636 missense probably damaging 1.00
IGL01590:Ehbp1 APN 11 22095611 missense possibly damaging 0.91
IGL01611:Ehbp1 APN 11 22172883 missense probably damaging 0.98
IGL01636:Ehbp1 APN 11 22089584 missense probably benign 0.03
IGL01728:Ehbp1 APN 11 22101115 missense probably damaging 1.00
IGL02012:Ehbp1 APN 11 22101218 missense probably damaging 1.00
IGL02034:Ehbp1 APN 11 22285486 critical splice donor site probably null
IGL02324:Ehbp1 APN 11 22096048 missense probably damaging 1.00
IGL02511:Ehbp1 APN 11 22089653 missense probably damaging 1.00
trajan UTSW 11 22151850 missense probably damaging 1.00
K7894:Ehbp1 UTSW 11 22089683 splice site probably benign
PIT4418001:Ehbp1 UTSW 11 22053494 missense probably damaging 1.00
R0218:Ehbp1 UTSW 11 22231992 splice site probably benign
R0294:Ehbp1 UTSW 11 22095427 missense probably benign 0.27
R0398:Ehbp1 UTSW 11 22095886 missense probably damaging 0.99
R0420:Ehbp1 UTSW 11 22151836 missense probably benign
R0468:Ehbp1 UTSW 11 22169184 splice site probably benign
R0943:Ehbp1 UTSW 11 22095883 missense probably benign 0.12
R1181:Ehbp1 UTSW 11 22062831 missense probably benign 0.25
R1481:Ehbp1 UTSW 11 22006782 makesense probably null
R1493:Ehbp1 UTSW 11 22006866 missense probably damaging 1.00
R1563:Ehbp1 UTSW 11 22059231 missense probably damaging 1.00
R1648:Ehbp1 UTSW 11 22096000 missense probably damaging 1.00
R1656:Ehbp1 UTSW 11 22146694 missense probably benign
R1696:Ehbp1 UTSW 11 22053441 missense probably damaging 0.99
R1923:Ehbp1 UTSW 11 22151850 missense probably damaging 1.00
R1950:Ehbp1 UTSW 11 22059228 missense probably damaging 1.00
R2263:Ehbp1 UTSW 11 22095462 missense probably benign
R2436:Ehbp1 UTSW 11 22089524 critical splice donor site probably null
R3148:Ehbp1 UTSW 11 22100465 missense probably damaging 1.00
R3973:Ehbp1 UTSW 11 22137867 missense probably benign 0.00
R3974:Ehbp1 UTSW 11 22137867 missense probably benign 0.00
R4030:Ehbp1 UTSW 11 22285498 missense probably damaging 1.00
R4085:Ehbp1 UTSW 11 22095898 missense possibly damaging 0.95
R4089:Ehbp1 UTSW 11 22095898 missense possibly damaging 0.95
R4524:Ehbp1 UTSW 11 22151843 missense probably damaging 1.00
R4641:Ehbp1 UTSW 11 22095892 missense probably benign 0.00
R4873:Ehbp1 UTSW 11 22101164 missense probably damaging 1.00
R4875:Ehbp1 UTSW 11 22101164 missense probably damaging 1.00
R4914:Ehbp1 UTSW 11 22146592 missense probably benign 0.20
R4915:Ehbp1 UTSW 11 22146592 missense probably benign 0.20
R4916:Ehbp1 UTSW 11 22146592 missense probably benign 0.20
R4917:Ehbp1 UTSW 11 22146592 missense probably benign 0.20
R4918:Ehbp1 UTSW 11 22146592 missense probably benign 0.20
R4929:Ehbp1 UTSW 11 22239169 missense possibly damaging 0.48
R4995:Ehbp1 UTSW 11 22101073 missense probably damaging 1.00
R5325:Ehbp1 UTSW 11 22095370 missense possibly damaging 0.93
R5579:Ehbp1 UTSW 11 22137846 missense probably damaging 1.00
R5979:Ehbp1 UTSW 11 22151887 missense probably benign 0.06
R6025:Ehbp1 UTSW 11 22239156 missense probably damaging 1.00
R6259:Ehbp1 UTSW 11 22285684 start gained probably benign
R6685:Ehbp1 UTSW 11 22146641 missense probably benign 0.01
R6893:Ehbp1 UTSW 11 22014945 missense probably damaging 1.00
R7127:Ehbp1 UTSW 11 22053529 nonsense probably null
R7465:Ehbp1 UTSW 11 22138001 missense probably benign
R7722:Ehbp1 UTSW 11 22089572 missense probably null
R7724:Ehbp1 UTSW 11 22089572 missense probably null
R7797:Ehbp1 UTSW 11 22096109 missense possibly damaging 0.79
R7868:Ehbp1 UTSW 11 22146542 nonsense probably null
R8088:Ehbp1 UTSW 11 22089572 missense probably null
R8218:Ehbp1 UTSW 11 22096096 missense possibly damaging 0.77
R8235:Ehbp1 UTSW 11 22239153 missense probably damaging 1.00
R8267:Ehbp1 UTSW 11 22146562 missense probably benign 0.02
R8318:Ehbp1 UTSW 11 22137980 missense probably benign 0.05
R8425:Ehbp1 UTSW 11 22013495 missense probably damaging 1.00
R8439:Ehbp1 UTSW 11 22096109 missense possibly damaging 0.79
R8493:Ehbp1 UTSW 11 22285842 start gained probably benign
R8745:Ehbp1 UTSW 11 22169064 missense possibly damaging 0.78
R8824:Ehbp1 UTSW 11 22232053 missense probably damaging 0.98
RF016:Ehbp1 UTSW 11 22146646 missense probably benign
RF037:Ehbp1 UTSW 11 22006783 small deletion probably benign
X0018:Ehbp1 UTSW 11 22101085 missense probably damaging 1.00
Z1176:Ehbp1 UTSW 11 22095590 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GACCTCTCAGATTCCCGAAATG -3'
(R):5'- GCAGCTCCAATCTTCTAGAAGTG -3'

Sequencing Primer
(F):5'- CTCAGATTCCCGAAATGAACTTTC -3'
(R):5'- GGTTTGGGGCATGAAACCC -3'
Posted On2020-09-02