Incidental Mutation 'R8334:Cpsf1'
ID644546
Institutional Source Beutler Lab
Gene Symbol Cpsf1
Ensembl Gene ENSMUSG00000034022
Gene Namecleavage and polyadenylation specific factor 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.970) question?
Stock #R8334 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location76595803-76607591 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 76603587 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 77 (N77K)
Ref Sequence ENSEMBL: ENSMUSP00000071794 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071898] [ENSMUST00000230157] [ENSMUST00000231042]
Predicted Effect probably benign
Transcript: ENSMUST00000071898
AA Change: N77K

PolyPhen 2 Score 0.259 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000071794
Gene: ENSMUSG00000034022
AA Change: N77K

DomainStartEndE-ValueType
Pfam:MMS1_N 92 684 7.2e-42 PFAM
low complexity region 902 910 N/A INTRINSIC
Pfam:CPSF_A 1071 1407 4.9e-94 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000230157
AA Change: N77K

PolyPhen 2 Score 0.346 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000231042
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (63/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cleavage and polyadenylation specificity factor (CPSF) is a multisubunit complex that plays a central role in 3-prime processing of pre-mRNAs. CPSF recognizes the AAUAAA signal in the pre-mRNA and interacts with other proteins to facilitate both RNA cleavage and poly(A) synthesis. CPSF1 is the largest subunit of the CPSF complex (Murthy and Manley, 1995 [PubMed 7590244]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530077C05Rik A G 9: 22,444,118 E483G probably benign Het
Abca8a A T 11: 110,068,824 S696T probably damaging Het
Abhd12 T C 2: 150,858,453 I75V probably benign Het
Adamts9 T C 6: 92,937,244 probably null Het
Ap2a1 C T 7: 44,904,711 V499I possibly damaging Het
Arhgef16 T A 4: 154,282,767 K394* probably null Het
Armc2 A G 10: 41,923,765 F699S probably damaging Het
Atat1 C T 17: 35,909,258 probably null Het
Atm A G 9: 53,522,273 S226P probably benign Het
Bcas3 A G 11: 85,576,811 T687A possibly damaging Het
Bmp2k T C 5: 97,027,894 M78T possibly damaging Het
Brinp3 T A 1: 146,902,053 L746H probably damaging Het
Capn8 G A 1: 182,611,105 probably null Het
Ccdc154 T A 17: 25,171,607 F602I probably damaging Het
Celsr3 CGGGG CGGGGG 9: 108,841,272 probably null Het
Chd3 A G 11: 69,350,796 F1504L probably damaging Het
Crybb3 T A 5: 113,075,979 Q188L possibly damaging Het
Dnah8 T A 17: 30,769,831 H3258Q probably benign Het
Dnajb6 C T 5: 29,781,240 R269W unknown Het
Dusp9 TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG X: 73,640,611 probably benign Het
Ech1 A G 7: 28,831,823 I279V probably benign Het
Ehbp1 C A 11: 22,007,170 R1173L probably damaging Het
Ehd4 T C 2: 120,137,064 E83G probably damaging Het
Epha7 A G 4: 28,938,777 E544G probably benign Het
Esp23 A G 17: 39,073,904 V67A possibly damaging Het
Etl4 T C 2: 20,781,046 V726A probably damaging Het
Fbxo39 G A 11: 72,317,644 W274* probably null Het
Filip1l T C 16: 57,570,147 I366T probably benign Het
Gm4841 T C 18: 60,270,982 D13G probably benign Het
Gm6205 T G 5: 94,682,776 N44K probably benign Het
Gtpbp2 T A 17: 46,166,442 F411Y possibly damaging Het
Kmt5b G T 19: 3,814,795 V620L probably benign Het
Lrrc24 T C 15: 76,716,000 Q313R probably benign Het
Lsm1 A G 8: 25,802,019 E108G probably benign Het
Macf1 T C 4: 123,432,108 K5201E possibly damaging Het
Mki67 G T 7: 135,696,516 T2263K probably damaging Het
Mroh1 G A 15: 76,446,556 G1156S probably benign Het
Ncor1 A T 11: 62,383,244 M190K probably damaging Het
Nsmce3 A G 7: 64,872,719 V67A probably damaging Het
Nuggc T C 14: 65,645,029 V741A probably benign Het
Olfm3 G T 3: 115,122,557 L379F probably damaging Het
Olfr1274-ps T C 2: 90,400,933 S91P probably benign Het
Olfr935 T A 9: 38,994,593 I281F probably benign Het
Pcdhb13 A G 18: 37,444,800 T744A probably damaging Het
Plek T C 11: 16,983,220 T298A probably benign Het
Pou5f2 A G 13: 78,025,273 I111M probably benign Het
Pou6f2 C T 13: 18,125,406 R556H probably damaging Het
Rcor1 G A 12: 111,093,095 A148T Het
Rnh1 A G 7: 141,168,631 V11A probably benign Het
Rrnad1 C T 3: 87,927,749 V31I possibly damaging Het
Slc35f1 T C 10: 53,108,148 F335L possibly damaging Het
Srrm2 T C 17: 23,808,356 V22A unknown Het
St7 A T 6: 17,934,221 H534L probably damaging Het
Swi5 T A 2: 32,280,451 probably benign Het
Syf2 T A 4: 134,931,275 H40Q probably benign Het
Tgtp2 G A 11: 49,058,894 L284F probably benign Het
Tnn C T 1: 160,118,483 G922R probably damaging Het
Trbc1 A C 6: 41,539,112 probably benign Het
Trim33 A T 3: 103,353,829 T1115S probably benign Het
Ttc22 C A 4: 106,638,918 probably null Het
Ttn C T 2: 76,808,030 A13969T probably damaging Het
Tuba4a T C 1: 75,217,301 D74G probably benign Het
Ube3c T A 5: 29,590,884 D90E probably benign Het
Ubr7 T C 12: 102,758,138 V37A probably damaging Het
Vmn2r28 A C 7: 5,484,060 C535G probably damaging Het
Wdr36 A G 18: 32,859,293 T628A possibly damaging Het
Whrn C T 4: 63,494,810 V142M probably damaging Het
Wnk2 A T 13: 49,050,482 probably null Het
Xkr7 C T 2: 153,054,963 T579I probably damaging Het
Other mutations in Cpsf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00499:Cpsf1 APN 15 76600216 missense probably benign 0.27
IGL01013:Cpsf1 APN 15 76599297 nonsense probably null
IGL01599:Cpsf1 APN 15 76596541 missense probably damaging 1.00
IGL02008:Cpsf1 APN 15 76603091 missense probably damaging 1.00
IGL02291:Cpsf1 APN 15 76602821 missense probably damaging 1.00
IGL02901:Cpsf1 APN 15 76599496 nonsense probably null
IGL02929:Cpsf1 APN 15 76602127 critical splice donor site probably null
IGL03402:Cpsf1 APN 15 76596003 splice site probably null
R0005:Cpsf1 UTSW 15 76600680 critical splice donor site probably null
R0044:Cpsf1 UTSW 15 76599553 missense probably benign
R0044:Cpsf1 UTSW 15 76599553 missense probably benign
R0487:Cpsf1 UTSW 15 76597002 missense probably damaging 1.00
R0510:Cpsf1 UTSW 15 76603657 intron probably benign
R0630:Cpsf1 UTSW 15 76601971 missense probably damaging 1.00
R0780:Cpsf1 UTSW 15 76600377 missense probably benign 0.17
R1617:Cpsf1 UTSW 15 76602370 nonsense probably null
R1717:Cpsf1 UTSW 15 76602566 missense possibly damaging 0.77
R1889:Cpsf1 UTSW 15 76602156 missense probably benign 0.06
R1994:Cpsf1 UTSW 15 76603160 missense probably benign 0.03
R2168:Cpsf1 UTSW 15 76603737 missense possibly damaging 0.69
R2359:Cpsf1 UTSW 15 76597673 missense probably benign 0.02
R2697:Cpsf1 UTSW 15 76599329 missense probably damaging 1.00
R2847:Cpsf1 UTSW 15 76602851 missense probably damaging 1.00
R2848:Cpsf1 UTSW 15 76602851 missense probably damaging 1.00
R3409:Cpsf1 UTSW 15 76601781 nonsense probably null
R3410:Cpsf1 UTSW 15 76601781 nonsense probably null
R3815:Cpsf1 UTSW 15 76601149 missense probably benign 0.22
R4030:Cpsf1 UTSW 15 76601779 missense possibly damaging 0.96
R4491:Cpsf1 UTSW 15 76597722 missense possibly damaging 0.85
R4615:Cpsf1 UTSW 15 76596937 missense possibly damaging 0.88
R5227:Cpsf1 UTSW 15 76598948 missense probably damaging 1.00
R5353:Cpsf1 UTSW 15 76602571 missense probably damaging 1.00
R5548:Cpsf1 UTSW 15 76597327 missense possibly damaging 0.95
R5552:Cpsf1 UTSW 15 76599646 missense probably benign 0.27
R5746:Cpsf1 UTSW 15 76599837 missense probably benign 0.01
R6319:Cpsf1 UTSW 15 76596967 missense probably damaging 1.00
R6360:Cpsf1 UTSW 15 76597455 frame shift probably null
R6572:Cpsf1 UTSW 15 76597455 frame shift probably null
R6574:Cpsf1 UTSW 15 76597455 frame shift probably null
R6576:Cpsf1 UTSW 15 76597455 frame shift probably null
R6577:Cpsf1 UTSW 15 76597455 frame shift probably null
R6588:Cpsf1 UTSW 15 76596822 missense probably damaging 1.00
R6595:Cpsf1 UTSW 15 76602510 missense probably damaging 1.00
R6621:Cpsf1 UTSW 15 76603519 missense probably damaging 1.00
R6880:Cpsf1 UTSW 15 76602539 missense probably benign 0.06
R6954:Cpsf1 UTSW 15 76599496 missense probably damaging 1.00
R7100:Cpsf1 UTSW 15 76596114 missense possibly damaging 0.73
R7255:Cpsf1 UTSW 15 76597543 missense probably damaging 1.00
R7318:Cpsf1 UTSW 15 76597275 nonsense probably null
R7371:Cpsf1 UTSW 15 76600575 missense probably damaging 1.00
R7387:Cpsf1 UTSW 15 76602566 missense possibly damaging 0.77
R7446:Cpsf1 UTSW 15 76601750 missense probably benign
R7612:Cpsf1 UTSW 15 76597009 missense probably benign 0.00
R7739:Cpsf1 UTSW 15 76600311 missense probably benign 0.00
R7878:Cpsf1 UTSW 15 76600500 missense probably damaging 1.00
R8345:Cpsf1 UTSW 15 76601490 missense probably benign
R8382:Cpsf1 UTSW 15 76600951 missense probably benign
R8403:Cpsf1 UTSW 15 76600283 missense probably damaging 0.96
X0052:Cpsf1 UTSW 15 76596302 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- CATGAGTGCCTGGGTCATACTC -3'
(R):5'- TCCAGGCTCTGACCAAGAATG -3'

Sequencing Primer
(F):5'- AGGTCAGAAGCATGGCCCATTC -3'
(R):5'- CTCTGACCAAGAATGATGGGAGC -3'
Posted On2020-09-02