Incidental Mutation 'R8334:Lrrc24'
ID644547
Institutional Source Beutler Lab
Gene Symbol Lrrc24
Ensembl Gene ENSMUSG00000033707
Gene Nameleucine rich repeat containing 24
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock #R8334 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location76715276-76722173 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 76716000 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 313 (Q313R)
Ref Sequence ENSEMBL: ENSMUSP00000061906 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036423] [ENSMUST00000049956] [ENSMUST00000127208] [ENSMUST00000136840] [ENSMUST00000137649] [ENSMUST00000142610] [ENSMUST00000155225] [ENSMUST00000155735]
Predicted Effect probably benign
Transcript: ENSMUST00000036423
SMART Domains Protein: ENSMUSP00000049466
Gene: ENSMUSG00000033728

DomainStartEndE-ValueType
low complexity region 23 35 N/A INTRINSIC
low complexity region 55 66 N/A INTRINSIC
SCOP:d1a4ya_ 222 413 2e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000049956
AA Change: Q313R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000061906
Gene: ENSMUSG00000033707
AA Change: Q313R

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
LRRNT 30 62 1.04e-2 SMART
LRR 61 80 3.18e2 SMART
LRR_TYP 81 104 2.99e-4 SMART
LRR 106 128 3.87e1 SMART
LRR_TYP 129 152 8.22e-2 SMART
LRR_TYP 153 176 5.06e-2 SMART
LRR 177 200 2.02e-1 SMART
LRRCT 212 266 2e-10 SMART
IGc2 280 360 1.02e-9 SMART
transmembrane domain 409 431 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127208
SMART Domains Protein: ENSMUSP00000114921
Gene: ENSMUSG00000033728

DomainStartEndE-ValueType
low complexity region 23 35 N/A INTRINSIC
low complexity region 55 66 N/A INTRINSIC
SCOP:d1a4ya_ 222 413 2e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000136840
SMART Domains Protein: ENSMUSP00000119670
Gene: ENSMUSG00000033728

DomainStartEndE-ValueType
low complexity region 23 35 N/A INTRINSIC
low complexity region 55 66 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000137649
SMART Domains Protein: ENSMUSP00000121982
Gene: ENSMUSG00000033728

DomainStartEndE-ValueType
low complexity region 23 35 N/A INTRINSIC
low complexity region 55 66 N/A INTRINSIC
SCOP:d1a4ya_ 222 413 2e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138132
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142506
Predicted Effect probably benign
Transcript: ENSMUST00000142610
SMART Domains Protein: ENSMUSP00000117780
Gene: ENSMUSG00000033728

DomainStartEndE-ValueType
low complexity region 23 35 N/A INTRINSIC
low complexity region 55 66 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146725
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146855
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154531
Predicted Effect probably benign
Transcript: ENSMUST00000155225
Predicted Effect probably benign
Transcript: ENSMUST00000155735
SMART Domains Protein: ENSMUSP00000115446
Gene: ENSMUSG00000033728

DomainStartEndE-ValueType
low complexity region 23 35 N/A INTRINSIC
low complexity region 55 66 N/A INTRINSIC
SCOP:d1a4ya_ 222 413 2e-13 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (63/64)
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530077C05Rik A G 9: 22,444,118 E483G probably benign Het
Abca8a A T 11: 110,068,824 S696T probably damaging Het
Abhd12 T C 2: 150,858,453 I75V probably benign Het
Adamts9 T C 6: 92,937,244 probably null Het
Ap2a1 C T 7: 44,904,711 V499I possibly damaging Het
Arhgef16 T A 4: 154,282,767 K394* probably null Het
Armc2 A G 10: 41,923,765 F699S probably damaging Het
Atat1 C T 17: 35,909,258 probably null Het
Atm A G 9: 53,522,273 S226P probably benign Het
Bcas3 A G 11: 85,576,811 T687A possibly damaging Het
Bmp2k T C 5: 97,027,894 M78T possibly damaging Het
Brinp3 T A 1: 146,902,053 L746H probably damaging Het
Capn8 G A 1: 182,611,105 probably null Het
Ccdc154 T A 17: 25,171,607 F602I probably damaging Het
Celsr3 CGGGG CGGGGG 9: 108,841,272 probably null Het
Chd3 A G 11: 69,350,796 F1504L probably damaging Het
Cpsf1 A T 15: 76,603,587 N77K probably benign Het
Crybb3 T A 5: 113,075,979 Q188L possibly damaging Het
Dnah8 T A 17: 30,769,831 H3258Q probably benign Het
Dnajb6 C T 5: 29,781,240 R269W unknown Het
Dusp9 TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG X: 73,640,611 probably benign Het
Ech1 A G 7: 28,831,823 I279V probably benign Het
Ehbp1 C A 11: 22,007,170 R1173L probably damaging Het
Ehd4 T C 2: 120,137,064 E83G probably damaging Het
Epha7 A G 4: 28,938,777 E544G probably benign Het
Esp23 A G 17: 39,073,904 V67A possibly damaging Het
Etl4 T C 2: 20,781,046 V726A probably damaging Het
Fbxo39 G A 11: 72,317,644 W274* probably null Het
Filip1l T C 16: 57,570,147 I366T probably benign Het
Gm4841 T C 18: 60,270,982 D13G probably benign Het
Gm6205 T G 5: 94,682,776 N44K probably benign Het
Gtpbp2 T A 17: 46,166,442 F411Y possibly damaging Het
Kmt5b G T 19: 3,814,795 V620L probably benign Het
Lsm1 A G 8: 25,802,019 E108G probably benign Het
Macf1 T C 4: 123,432,108 K5201E possibly damaging Het
Mki67 G T 7: 135,696,516 T2263K probably damaging Het
Mroh1 G A 15: 76,446,556 G1156S probably benign Het
Ncor1 A T 11: 62,383,244 M190K probably damaging Het
Nsmce3 A G 7: 64,872,719 V67A probably damaging Het
Nuggc T C 14: 65,645,029 V741A probably benign Het
Olfm3 G T 3: 115,122,557 L379F probably damaging Het
Olfr1274-ps T C 2: 90,400,933 S91P probably benign Het
Olfr935 T A 9: 38,994,593 I281F probably benign Het
Pcdhb13 A G 18: 37,444,800 T744A probably damaging Het
Plek T C 11: 16,983,220 T298A probably benign Het
Pou5f2 A G 13: 78,025,273 I111M probably benign Het
Pou6f2 C T 13: 18,125,406 R556H probably damaging Het
Rcor1 G A 12: 111,093,095 A148T Het
Rnh1 A G 7: 141,168,631 V11A probably benign Het
Rrnad1 C T 3: 87,927,749 V31I possibly damaging Het
Slc35f1 T C 10: 53,108,148 F335L possibly damaging Het
Srrm2 T C 17: 23,808,356 V22A unknown Het
St7 A T 6: 17,934,221 H534L probably damaging Het
Swi5 T A 2: 32,280,451 probably benign Het
Syf2 T A 4: 134,931,275 H40Q probably benign Het
Tgtp2 G A 11: 49,058,894 L284F probably benign Het
Tnn C T 1: 160,118,483 G922R probably damaging Het
Trbc1 A C 6: 41,539,112 probably benign Het
Trim33 A T 3: 103,353,829 T1115S probably benign Het
Ttc22 C A 4: 106,638,918 probably null Het
Ttn C T 2: 76,808,030 A13969T probably damaging Het
Tuba4a T C 1: 75,217,301 D74G probably benign Het
Ube3c T A 5: 29,590,884 D90E probably benign Het
Ubr7 T C 12: 102,758,138 V37A probably damaging Het
Vmn2r28 A C 7: 5,484,060 C535G probably damaging Het
Wdr36 A G 18: 32,859,293 T628A possibly damaging Het
Whrn C T 4: 63,494,810 V142M probably damaging Het
Wnk2 A T 13: 49,050,482 probably null Het
Xkr7 C T 2: 153,054,963 T579I probably damaging Het
Other mutations in Lrrc24
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00519:Lrrc24 APN 15 76718063 missense probably damaging 1.00
IGL01556:Lrrc24 APN 15 76722575 missense probably damaging 0.99
IGL01940:Lrrc24 APN 15 76716057 missense probably damaging 1.00
IGL01966:Lrrc24 APN 15 76718311 missense probably benign 0.22
IGL02315:Lrrc24 APN 15 76718306 missense probably damaging 1.00
IGL03062:Lrrc24 APN 15 76718304 missense probably benign
R0240:Lrrc24 UTSW 15 76723209 missense probably damaging 1.00
R0240:Lrrc24 UTSW 15 76723209 missense probably damaging 1.00
R0365:Lrrc24 UTSW 15 76715784 missense probably benign 0.14
R1430:Lrrc24 UTSW 15 76723792 splice site probably null
R1789:Lrrc24 UTSW 15 76722578 missense probably benign 0.02
R2131:Lrrc24 UTSW 15 76715581 missense possibly damaging 0.92
R2202:Lrrc24 UTSW 15 76722911 missense probably damaging 1.00
R4247:Lrrc24 UTSW 15 76717976 missense possibly damaging 0.89
R4585:Lrrc24 UTSW 15 76723689 missense probably damaging 1.00
R4944:Lrrc24 UTSW 15 76718346 missense probably damaging 1.00
R4976:Lrrc24 UTSW 15 76716000 missense probably benign 0.00
R5119:Lrrc24 UTSW 15 76716000 missense probably benign 0.00
R5445:Lrrc24 UTSW 15 76716106 missense probably benign 0.10
R5772:Lrrc24 UTSW 15 76722710 missense probably damaging 1.00
R7795:Lrrc24 UTSW 15 76718048 missense probably benign 0.43
X0028:Lrrc24 UTSW 15 76715913 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGATGCGTTGACCAGTAGATG -3'
(R):5'- GAAGATCACATGTGCAGAGCCC -3'

Sequencing Primer
(F):5'- TGAAAGGGCACTCGAGCTTTG -3'
(R):5'- TGGCGCTACAGAGTCTACTAG -3'
Posted On2020-09-02