Incidental Mutation 'R8334:Filip1l'
ID 644548
Institutional Source Beutler Lab
Gene Symbol Filip1l
Ensembl Gene ENSMUSG00000043336
Gene Name filamin A interacting protein 1-like
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8334 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 57353093-57573126 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 57570147 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 366 (I366T)
Ref Sequence ENSEMBL: ENSMUSP00000124179 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114371] [ENSMUST00000159414] [ENSMUST00000159816] [ENSMUST00000232413]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000114371
SMART Domains Protein: ENSMUSP00000110011
Gene: ENSMUSG00000022748

DomainStartEndE-ValueType
low complexity region 13 29 N/A INTRINSIC
Pfam:CMS1 42 266 7.9e-35 PFAM
Pfam:DEAD 127 234 4e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159414
AA Change: I128T

PolyPhen 2 Score 0.180 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000124069
Gene: ENSMUSG00000043336
AA Change: I128T

DomainStartEndE-ValueType
coiled coil region 4 345 N/A INTRINSIC
coiled coil region 371 542 N/A INTRINSIC
low complexity region 589 602 N/A INTRINSIC
low complexity region 868 879 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159816
AA Change: I366T

PolyPhen 2 Score 0.180 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000124179
Gene: ENSMUSG00000043336
AA Change: I366T

DomainStartEndE-ValueType
Pfam:CortBP2 61 246 1.8e-65 PFAM
low complexity region 271 286 N/A INTRINSIC
low complexity region 483 495 N/A INTRINSIC
coiled coil region 609 780 N/A INTRINSIC
low complexity region 827 840 N/A INTRINSIC
low complexity region 1106 1117 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000232413
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (63/64)
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530077C05Rik A G 9: 22,444,118 E483G probably benign Het
Abca8a A T 11: 110,068,824 S696T probably damaging Het
Abhd12 T C 2: 150,858,453 I75V probably benign Het
Adamts9 T C 6: 92,937,244 probably null Het
Ap2a1 C T 7: 44,904,711 V499I possibly damaging Het
Arhgef16 T A 4: 154,282,767 K394* probably null Het
Armc2 A G 10: 41,923,765 F699S probably damaging Het
Atat1 C T 17: 35,909,258 probably null Het
Atm A G 9: 53,522,273 S226P probably benign Het
Bcas3 A G 11: 85,576,811 T687A possibly damaging Het
Bmp2k T C 5: 97,027,894 M78T possibly damaging Het
Brinp3 T A 1: 146,902,053 L746H probably damaging Het
Capn8 G A 1: 182,611,105 probably null Het
Ccdc154 T A 17: 25,171,607 F602I probably damaging Het
Celsr3 CGGGG CGGGGG 9: 108,841,272 probably null Het
Chd3 A G 11: 69,350,796 F1504L probably damaging Het
Cpsf1 A T 15: 76,603,587 N77K probably benign Het
Crybb3 T A 5: 113,075,979 Q188L possibly damaging Het
Dnah8 T A 17: 30,769,831 H3258Q probably benign Het
Dnajb6 C T 5: 29,781,240 R269W unknown Het
Dusp9 TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG X: 73,640,611 probably benign Het
Ech1 A G 7: 28,831,823 I279V probably benign Het
Ehbp1 C A 11: 22,007,170 R1173L probably damaging Het
Ehd4 T C 2: 120,137,064 E83G probably damaging Het
Epha7 A G 4: 28,938,777 E544G probably benign Het
Esp23 A G 17: 39,073,904 V67A possibly damaging Het
Etl4 T C 2: 20,781,046 V726A probably damaging Het
Fbxo39 G A 11: 72,317,644 W274* probably null Het
Gm4841 T C 18: 60,270,982 D13G probably benign Het
Gm6205 T G 5: 94,682,776 N44K probably benign Het
Gtpbp2 T A 17: 46,166,442 F411Y possibly damaging Het
Kmt5b G T 19: 3,814,795 V620L probably benign Het
Lrrc24 T C 15: 76,716,000 Q313R probably benign Het
Lsm1 A G 8: 25,802,019 E108G probably benign Het
Macf1 T C 4: 123,432,108 K5201E possibly damaging Het
Mki67 G T 7: 135,696,516 T2263K probably damaging Het
Mroh1 G A 15: 76,446,556 G1156S probably benign Het
Ncor1 A T 11: 62,383,244 M190K probably damaging Het
Nsmce3 A G 7: 64,872,719 V67A probably damaging Het
Nuggc T C 14: 65,645,029 V741A probably benign Het
Olfm3 G T 3: 115,122,557 L379F probably damaging Het
Olfr1274-ps T C 2: 90,400,933 S91P probably benign Het
Olfr935 T A 9: 38,994,593 I281F probably benign Het
Pcdhb13 A G 18: 37,444,800 T744A probably damaging Het
Plek T C 11: 16,983,220 T298A probably benign Het
Pou5f2 A G 13: 78,025,273 I111M probably benign Het
Pou6f2 C T 13: 18,125,406 R556H probably damaging Het
Rcor1 G A 12: 111,093,095 A148T Het
Rnh1 A G 7: 141,168,631 V11A probably benign Het
Rrnad1 C T 3: 87,927,749 V31I possibly damaging Het
Slc35f1 T C 10: 53,108,148 F335L possibly damaging Het
Srrm2 T C 17: 23,808,356 V22A unknown Het
St7 A T 6: 17,934,221 H534L probably damaging Het
Swi5 T A 2: 32,280,451 probably benign Het
Syf2 T A 4: 134,931,275 H40Q probably benign Het
Tgtp2 G A 11: 49,058,894 L284F probably benign Het
Tnn C T 1: 160,118,483 G922R probably damaging Het
Trbc1 A C 6: 41,539,112 probably benign Het
Trim33 A T 3: 103,353,829 T1115S probably benign Het
Ttc22 C A 4: 106,638,918 probably null Het
Ttn C T 2: 76,808,030 A13969T probably damaging Het
Tuba4a T C 1: 75,217,301 D74G probably benign Het
Ube3c T A 5: 29,590,884 D90E probably benign Het
Ubr7 T C 12: 102,758,138 V37A probably damaging Het
Vmn2r28 A C 7: 5,484,060 C535G probably damaging Het
Wdr36 A G 18: 32,859,293 T628A possibly damaging Het
Whrn C T 4: 63,494,810 V142M probably damaging Het
Wnk2 A T 13: 49,050,482 probably null Het
Xkr7 C T 2: 153,054,963 T579I probably damaging Het
Other mutations in Filip1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01294:Filip1l APN 16 57572348 nonsense probably null
IGL01393:Filip1l APN 16 57572223 missense probably damaging 1.00
IGL01886:Filip1l APN 16 57571250 missense possibly damaging 0.47
IGL02336:Filip1l APN 16 57571733 splice site probably null
IGL02503:Filip1l APN 16 57571575 missense probably benign 0.00
IGL02608:Filip1l APN 16 57572106 missense probably benign 0.05
IGL02681:Filip1l APN 16 57571779 missense probably benign 0.10
IGL02687:Filip1l APN 16 57571127 missense probably benign 0.30
IGL02982:Filip1l APN 16 57572232 missense probably damaging 1.00
IGL03062:Filip1l APN 16 57506804 missense probably damaging 1.00
R1027:Filip1l UTSW 16 57569688 missense probably benign
R1347:Filip1l UTSW 16 57570987 missense probably damaging 1.00
R1347:Filip1l UTSW 16 57570987 missense probably damaging 1.00
R1384:Filip1l UTSW 16 57571289 missense possibly damaging 0.61
R1655:Filip1l UTSW 16 57571851 missense probably damaging 1.00
R1764:Filip1l UTSW 16 57570038 missense probably damaging 1.00
R1809:Filip1l UTSW 16 57506660 missense probably benign
R1983:Filip1l UTSW 16 57571274 missense probably damaging 0.98
R2504:Filip1l UTSW 16 57570662 missense possibly damaging 0.76
R2504:Filip1l UTSW 16 57571047 missense probably damaging 0.97
R3117:Filip1l UTSW 16 57506732 missense probably benign 0.07
R3844:Filip1l UTSW 16 57572427 missense probably benign 0.15
R3871:Filip1l UTSW 16 57513286 missense probably damaging 0.97
R4231:Filip1l UTSW 16 57506768 missense probably benign
R4391:Filip1l UTSW 16 57570792 nonsense probably null
R4700:Filip1l UTSW 16 57570695 missense probably benign 0.00
R4999:Filip1l UTSW 16 57570415 missense probably benign 0.01
R5002:Filip1l UTSW 16 57571103 missense probably benign 0.01
R5123:Filip1l UTSW 16 57570662 missense possibly damaging 0.76
R5294:Filip1l UTSW 16 57570036 missense possibly damaging 0.59
R5429:Filip1l UTSW 16 57570255 missense probably damaging 0.99
R5811:Filip1l UTSW 16 57570294 missense probably damaging 1.00
R6220:Filip1l UTSW 16 57569989 missense probably benign 0.31
R6452:Filip1l UTSW 16 57506800 missense possibly damaging 0.82
R6678:Filip1l UTSW 16 57569970 missense probably benign 0.00
R6700:Filip1l UTSW 16 57571248 missense possibly damaging 0.86
R7260:Filip1l UTSW 16 57570924 missense probably damaging 1.00
R7327:Filip1l UTSW 16 57570937 missense probably damaging 1.00
R7578:Filip1l UTSW 16 57513282 missense probably damaging 0.99
R7691:Filip1l UTSW 16 57572433 missense probably benign 0.00
R7950:Filip1l UTSW 16 57569711 missense probably damaging 1.00
R8288:Filip1l UTSW 16 57570554 missense probably damaging 1.00
R8392:Filip1l UTSW 16 57571353 missense probably damaging 1.00
R8742:Filip1l UTSW 16 57571230 missense probably damaging 1.00
R9020:Filip1l UTSW 16 57570695 missense probably benign 0.00
R9157:Filip1l UTSW 16 57571617 missense probably benign 0.04
RF019:Filip1l UTSW 16 57570641 missense probably benign 0.07
Z1088:Filip1l UTSW 16 57513405 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTGACCACAAGTGCAAAGG -3'
(R):5'- CCAGAGCTGTGATCCTTACAC -3'

Sequencing Primer
(F):5'- TTGCTGAGGCCAGAGCTCAG -3'
(R):5'- GAGCTGTGATCCTTACACTAAGTTTG -3'
Posted On 2020-09-02