Incidental Mutation 'R8335:Tnn'
ID 644560
Institutional Source Beutler Lab
Gene Symbol Tnn
Ensembl Gene ENSMUSG00000026725
Gene Name tenascin N
Synonyms tenascin-W, Tnw
MMRRC Submission 067863-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.396) question?
Stock # R8335 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 159912599-159981150 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 159946053 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glycine to Arginine at position 922 (G922R)
Ref Sequence ENSEMBL: ENSMUSP00000039452 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039178] [ENSMUST00000131919]
AlphaFold Q80Z71
Predicted Effect probably damaging
Transcript: ENSMUST00000039178
AA Change: G922R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000039452
Gene: ENSMUSG00000026725
AA Change: G922R

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
coiled coil region 100 132 N/A INTRINSIC
EGF_like 170 198 3.5e1 SMART
EGF 201 229 2.29e1 SMART
EGF_like 232 260 2.86e1 SMART
FN3 262 341 1.81e-8 SMART
FN3 351 432 1.08e-6 SMART
FN3 443 521 1.19e-8 SMART
FN3 531 608 2.64e-10 SMART
FN3 619 696 1.6e-9 SMART
FN3 707 784 9.04e-9 SMART
FN3 795 872 7.34e-9 SMART
FN3 883 960 9.04e-9 SMART
FN3 971 1048 1.07e-10 SMART
FN3 1059 1136 7.57e-11 SMART
FN3 1147 1224 4.59e-10 SMART
FN3 1235 1312 1.95e-4 SMART
FBG 1327 1539 1.16e-114 SMART
Predicted Effect probably null
Transcript: ENSMUST00000131919
SMART Domains Protein: ENSMUSP00000115685
Gene: ENSMUSG00000026725

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
coiled coil region 100 132 N/A INTRINSIC
EGF_like 170 198 3.5e1 SMART
EGF 201 229 2.29e1 SMART
EGF_like 232 260 2.86e1 SMART
FN3 262 341 1.81e-8 SMART
FN3 351 432 1.08e-6 SMART
FN3 443 521 1.19e-8 SMART
FN3 531 608 2.64e-10 SMART
FN3 619 696 1.6e-9 SMART
FN3 707 784 9.04e-9 SMART
FN3 795 872 7.57e-11 SMART
FN3 883 960 4.59e-10 SMART
FN3 971 1048 1.95e-4 SMART
FBG 1063 1275 1.16e-114 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 97% (33/34)
Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ccdc47 C G 11: 106,099,084 (GRCm39) E202D possibly damaging Het
Ccdc47 T C 11: 106,099,085 (GRCm39) E202G probably damaging Het
Depdc1a C A 3: 159,228,859 (GRCm39) P537Q probably damaging Het
Dync2h1 A T 9: 7,084,941 (GRCm39) M2816K probably benign Het
Gatb T C 3: 85,481,628 (GRCm39) probably null Het
Gm6356 A G 14: 6,971,838 (GRCm38) M99T probably benign Het
Ighv1-67 A C 12: 115,567,744 (GRCm39) V56G probably damaging Het
Il27ra A T 8: 84,766,130 (GRCm39) L218Q probably damaging Het
Madd G A 2: 91,000,584 (GRCm39) R494C probably damaging Het
Mfsd8 G A 3: 40,789,628 (GRCm39) R140C probably damaging Het
Mink1 C T 11: 70,500,401 (GRCm39) R784W probably damaging Het
Mttp C T 3: 137,808,973 (GRCm39) D697N possibly damaging Het
Mug2 A T 6: 122,017,543 (GRCm39) M427L probably benign Het
Or10ag57 A G 2: 87,218,204 (GRCm39) I52V probably benign Het
Or13l2 T C 3: 97,318,024 (GRCm39) N158D probably benign Het
Or4a67 G T 2: 88,598,117 (GRCm39) P181T probably damaging Het
Or8k3b T A 2: 86,520,512 (GRCm39) D269V probably benign Het
Paxip1 T C 5: 27,971,122 (GRCm39) H409R unknown Het
Pkp3 T C 7: 140,667,669 (GRCm39) I490T probably damaging Het
Plekhg4 G T 8: 106,102,848 (GRCm39) V236L probably damaging Het
Pm20d2 T C 4: 33,189,245 (GRCm39) S46G probably benign Het
Prss33 A G 17: 24,053,569 (GRCm39) probably null Het
Ptpn3 A T 4: 57,235,286 (GRCm39) L358I probably damaging Het
Pxdn A G 12: 30,052,096 (GRCm39) T758A probably damaging Het
Sall3 G A 18: 81,012,801 (GRCm39) R1212C probably benign Het
Sox6 G A 7: 115,300,949 (GRCm39) L173F probably damaging Het
Spata20 T C 11: 94,373,369 (GRCm39) K501E probably benign Het
Stat2 G A 10: 128,112,452 (GRCm39) V31I possibly damaging Het
Synpo2 T A 3: 122,908,183 (GRCm39) N378Y probably damaging Het
Tacr2 A T 10: 62,100,946 (GRCm39) H352L probably benign Het
Tmem214 A G 5: 31,029,466 (GRCm39) K230E possibly damaging Het
Tnfsf8 A G 4: 63,752,352 (GRCm39) S238P probably damaging Het
Trhde A G 10: 114,322,609 (GRCm39) probably null Het
Ttc6 A G 12: 57,707,077 (GRCm39) I661M probably benign Het
Vmn1r209 T A 13: 22,989,977 (GRCm39) M238L probably damaging Het
Vmn2r29 A G 7: 7,234,445 (GRCm39) S814P probably damaging Het
Vsig10 T C 5: 117,486,435 (GRCm39) L448P probably damaging Het
Xpo1 T G 11: 23,230,603 (GRCm39) probably null Het
Zfp616 A T 11: 73,974,726 (GRCm39) K423* probably null Het
Other mutations in Tnn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Tnn APN 1 159,953,021 (GRCm39) missense possibly damaging 0.65
IGL00433:Tnn APN 1 159,925,776 (GRCm39) splice site probably benign
IGL00858:Tnn APN 1 159,915,962 (GRCm39) critical splice donor site probably null
IGL00939:Tnn APN 1 159,975,100 (GRCm39) missense probably damaging 1.00
IGL01569:Tnn APN 1 159,948,124 (GRCm39) missense possibly damaging 0.51
IGL01591:Tnn APN 1 159,953,144 (GRCm39) missense probably damaging 1.00
IGL01628:Tnn APN 1 159,975,172 (GRCm39) missense possibly damaging 0.89
IGL01811:Tnn APN 1 159,934,705 (GRCm39) missense probably damaging 1.00
IGL01813:Tnn APN 1 159,916,008 (GRCm39) missense probably damaging 1.00
IGL02340:Tnn APN 1 159,972,775 (GRCm39) missense probably benign 0.00
IGL02488:Tnn APN 1 159,968,163 (GRCm39) missense probably benign 0.21
IGL02535:Tnn APN 1 159,950,222 (GRCm39) splice site probably null
IGL02563:Tnn APN 1 159,942,123 (GRCm39) missense probably damaging 1.00
IGL02572:Tnn APN 1 159,913,677 (GRCm39) missense probably damaging 1.00
IGL02740:Tnn APN 1 159,968,347 (GRCm39) splice site probably benign
IGL02818:Tnn APN 1 159,943,848 (GRCm39) missense possibly damaging 0.86
IGL03284:Tnn APN 1 159,953,022 (GRCm39) missense probably benign 0.01
1mM(1):Tnn UTSW 1 159,924,911 (GRCm39) missense probably damaging 1.00
PIT4305001:Tnn UTSW 1 159,913,647 (GRCm39) missense possibly damaging 0.91
R0023:Tnn UTSW 1 159,932,498 (GRCm39) missense probably benign 0.00
R0234:Tnn UTSW 1 159,916,036 (GRCm39) missense probably damaging 1.00
R0234:Tnn UTSW 1 159,916,036 (GRCm39) missense probably damaging 1.00
R0316:Tnn UTSW 1 159,948,137 (GRCm39) missense possibly damaging 0.93
R0492:Tnn UTSW 1 159,948,327 (GRCm39) missense probably damaging 0.99
R0547:Tnn UTSW 1 159,943,907 (GRCm39) intron probably benign
R1067:Tnn UTSW 1 159,952,968 (GRCm39) missense probably damaging 1.00
R1563:Tnn UTSW 1 159,952,985 (GRCm39) missense probably damaging 1.00
R1565:Tnn UTSW 1 159,924,835 (GRCm39) missense probably damaging 1.00
R1615:Tnn UTSW 1 159,945,978 (GRCm39) missense possibly damaging 0.93
R1637:Tnn UTSW 1 159,975,170 (GRCm39) missense probably damaging 1.00
R1707:Tnn UTSW 1 159,972,714 (GRCm39) missense probably damaging 1.00
R1758:Tnn UTSW 1 159,975,154 (GRCm39) missense possibly damaging 0.61
R1797:Tnn UTSW 1 159,968,258 (GRCm39) missense probably damaging 1.00
R1847:Tnn UTSW 1 159,943,752 (GRCm39) missense possibly damaging 0.51
R1925:Tnn UTSW 1 159,924,799 (GRCm39) missense probably damaging 1.00
R2182:Tnn UTSW 1 159,968,170 (GRCm39) splice site probably null
R2196:Tnn UTSW 1 159,924,798 (GRCm39) nonsense probably null
R2225:Tnn UTSW 1 159,975,035 (GRCm39) missense probably damaging 1.00
R2227:Tnn UTSW 1 159,975,035 (GRCm39) missense probably damaging 1.00
R2286:Tnn UTSW 1 159,938,079 (GRCm39) missense possibly damaging 0.89
R2850:Tnn UTSW 1 159,966,857 (GRCm39) missense probably benign 0.00
R3110:Tnn UTSW 1 159,943,856 (GRCm39) missense possibly damaging 0.71
R3111:Tnn UTSW 1 159,934,625 (GRCm39) missense probably damaging 0.98
R3112:Tnn UTSW 1 159,943,856 (GRCm39) missense possibly damaging 0.71
R3729:Tnn UTSW 1 159,973,810 (GRCm39) missense probably damaging 1.00
R4183:Tnn UTSW 1 159,924,925 (GRCm39) missense probably damaging 1.00
R4439:Tnn UTSW 1 159,943,650 (GRCm39) missense probably benign
R4441:Tnn UTSW 1 159,943,650 (GRCm39) missense probably benign
R4588:Tnn UTSW 1 159,972,681 (GRCm39) missense probably benign 0.25
R4646:Tnn UTSW 1 159,973,612 (GRCm39) missense probably benign
R4647:Tnn UTSW 1 159,973,612 (GRCm39) missense probably benign
R4648:Tnn UTSW 1 159,973,612 (GRCm39) missense probably benign
R4701:Tnn UTSW 1 159,975,338 (GRCm39) missense possibly damaging 0.72
R4703:Tnn UTSW 1 159,943,815 (GRCm39) missense possibly damaging 0.84
R4737:Tnn UTSW 1 159,973,659 (GRCm39) missense probably damaging 1.00
R4801:Tnn UTSW 1 159,972,603 (GRCm39) missense possibly damaging 0.90
R4802:Tnn UTSW 1 159,972,603 (GRCm39) missense possibly damaging 0.90
R4868:Tnn UTSW 1 159,958,443 (GRCm39) missense possibly damaging 0.64
R4977:Tnn UTSW 1 159,948,188 (GRCm39) missense probably damaging 1.00
R5011:Tnn UTSW 1 159,953,949 (GRCm39) missense possibly damaging 0.89
R5026:Tnn UTSW 1 159,973,707 (GRCm39) missense probably benign 0.00
R5027:Tnn UTSW 1 159,972,781 (GRCm39) missense probably damaging 1.00
R5049:Tnn UTSW 1 159,968,308 (GRCm39) missense probably benign 0.00
R5119:Tnn UTSW 1 159,948,122 (GRCm39) missense probably damaging 0.98
R5128:Tnn UTSW 1 159,950,464 (GRCm39) missense probably damaging 0.98
R5234:Tnn UTSW 1 159,972,569 (GRCm39) missense possibly damaging 0.95
R5398:Tnn UTSW 1 159,975,092 (GRCm39) missense probably benign 0.00
R5424:Tnn UTSW 1 159,950,272 (GRCm39) missense possibly damaging 0.69
R5452:Tnn UTSW 1 159,937,831 (GRCm39) missense probably benign 0.13
R5466:Tnn UTSW 1 159,948,106 (GRCm39) missense possibly damaging 0.93
R6022:Tnn UTSW 1 159,937,928 (GRCm39) missense probably benign 0.00
R6062:Tnn UTSW 1 159,925,848 (GRCm39) missense probably damaging 1.00
R6086:Tnn UTSW 1 159,913,690 (GRCm39) missense probably damaging 1.00
R6132:Tnn UTSW 1 159,973,641 (GRCm39) missense probably damaging 0.96
R6324:Tnn UTSW 1 159,972,774 (GRCm39) missense probably damaging 0.96
R6455:Tnn UTSW 1 159,942,289 (GRCm39) missense probably damaging 1.00
R6563:Tnn UTSW 1 159,915,968 (GRCm39) missense probably damaging 1.00
R6650:Tnn UTSW 1 159,942,153 (GRCm39) missense probably damaging 1.00
R6806:Tnn UTSW 1 159,948,278 (GRCm39) missense possibly damaging 0.95
R6810:Tnn UTSW 1 159,932,412 (GRCm39) missense probably damaging 1.00
R7157:Tnn UTSW 1 159,953,947 (GRCm39) nonsense probably null
R7243:Tnn UTSW 1 159,934,687 (GRCm39) missense probably benign 0.07
R7340:Tnn UTSW 1 159,973,592 (GRCm39) missense probably damaging 0.98
R7472:Tnn UTSW 1 159,937,917 (GRCm39) missense probably benign 0.12
R7502:Tnn UTSW 1 159,937,929 (GRCm39) missense probably benign 0.00
R7527:Tnn UTSW 1 159,946,074 (GRCm39) missense possibly damaging 0.51
R7608:Tnn UTSW 1 159,915,984 (GRCm39) nonsense probably null
R7746:Tnn UTSW 1 159,942,255 (GRCm39) missense probably damaging 0.97
R8096:Tnn UTSW 1 159,950,411 (GRCm39) missense probably damaging 1.00
R8136:Tnn UTSW 1 159,934,630 (GRCm39) missense probably damaging 0.96
R8191:Tnn UTSW 1 159,953,088 (GRCm39) missense probably damaging 1.00
R8334:Tnn UTSW 1 159,946,053 (GRCm39) missense probably damaging 1.00
R8337:Tnn UTSW 1 159,946,053 (GRCm39) missense probably damaging 1.00
R8338:Tnn UTSW 1 159,946,053 (GRCm39) missense probably damaging 1.00
R8427:Tnn UTSW 1 159,958,256 (GRCm39) missense probably damaging 0.99
R8433:Tnn UTSW 1 159,924,790 (GRCm39) missense possibly damaging 0.81
R8479:Tnn UTSW 1 159,950,397 (GRCm39) missense probably benign 0.06
R8505:Tnn UTSW 1 159,973,593 (GRCm39) missense probably damaging 0.98
R8554:Tnn UTSW 1 159,937,986 (GRCm39) missense probably damaging 1.00
R8717:Tnn UTSW 1 159,943,846 (GRCm39) missense possibly damaging 0.51
R8850:Tnn UTSW 1 159,937,814 (GRCm39) critical splice donor site probably null
R8928:Tnn UTSW 1 159,953,099 (GRCm39) missense probably damaging 1.00
R9209:Tnn UTSW 1 159,953,986 (GRCm39) missense probably benign 0.02
X0019:Tnn UTSW 1 159,913,716 (GRCm39) missense probably damaging 1.00
Z1176:Tnn UTSW 1 159,973,863 (GRCm39) missense probably benign
Z1177:Tnn UTSW 1 159,954,097 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GTCTCTTCCAGGAGCAGAGAAAG -3'
(R):5'- CCCAATGGTCTCAGTTTCTGG -3'

Sequencing Primer
(F):5'- TGAAATACGTCACATGCTCAGG -3'
(R):5'- CTCAGTTTCTGGAGACTGTTACTAG -3'
Posted On 2020-09-02