Incidental Mutation 'R8335:Tmem214'
ID644575
Institutional Source Beutler Lab
Gene Symbol Tmem214
Ensembl Gene ENSMUSG00000038828
Gene Nametransmembrane protein 214
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.626) question?
Stock #R8335 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location30868012-30879180 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 30872122 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 230 (K230E)
Ref Sequence ENSEMBL: ENSMUSP00000144615 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114716] [ENSMUST00000201203]
Predicted Effect possibly damaging
Transcript: ENSMUST00000114716
AA Change: K185E

PolyPhen 2 Score 0.520 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000110364
Gene: ENSMUSG00000038828
AA Change: K185E

DomainStartEndE-ValueType
low complexity region 16 36 N/A INTRINSIC
low complexity region 84 94 N/A INTRINSIC
Pfam:DUF2359 172 638 8e-247 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000201203
AA Change: K230E

PolyPhen 2 Score 0.846 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000144615
Gene: ENSMUSG00000038828
AA Change: K230E

DomainStartEndE-ValueType
low complexity region 16 36 N/A INTRINSIC
low complexity region 84 94 N/A INTRINSIC
Pfam:DUF2359 217 683 6.9e-246 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 97% (33/34)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ccdc47 C G 11: 106,208,258 E202D possibly damaging Het
Ccdc47 T C 11: 106,208,259 E202G probably damaging Het
Depdc1a C A 3: 159,523,222 P537Q probably damaging Het
Dync2h1 A T 9: 7,084,941 M2816K probably benign Het
Gatb T C 3: 85,574,321 probably null Het
Gm6356 A G 14: 6,971,838 M99T probably benign Het
Ighv1-67 A C 12: 115,604,124 V56G probably damaging Het
Il27ra A T 8: 84,039,501 L218Q probably damaging Het
Madd G A 2: 91,170,239 R494C probably damaging Het
Mfsd8 G A 3: 40,835,193 R140C probably damaging Het
Mink1 C T 11: 70,609,575 R784W probably damaging Het
Mttp C T 3: 138,103,212 D697N possibly damaging Het
Mug2 A T 6: 122,040,584 M427L probably benign Het
Olfr1087 T A 2: 86,690,168 D269V probably benign Het
Olfr1122 A G 2: 87,387,860 I52V probably benign Het
Olfr1200 G T 2: 88,767,773 P181T probably damaging Het
Olfr1402 T C 3: 97,410,708 N158D probably benign Het
Paxip1 T C 5: 27,766,124 H409R unknown Het
Pkp3 T C 7: 141,087,756 I490T probably damaging Het
Plekhg4 G T 8: 105,376,216 V236L probably damaging Het
Pm20d2 T C 4: 33,189,245 S46G probably benign Het
Prss33 A G 17: 23,834,595 probably null Het
Ptpn3 A T 4: 57,235,286 L358I probably damaging Het
Pxdn A G 12: 30,002,097 T758A probably damaging Het
Sall3 G A 18: 80,969,586 R1212C probably benign Het
Sox6 G A 7: 115,701,714 L173F probably damaging Het
Spata20 T C 11: 94,482,543 K501E probably benign Het
Stat2 G A 10: 128,276,583 V31I possibly damaging Het
Synpo2 T A 3: 123,114,534 N378Y probably damaging Het
Tacr2 A T 10: 62,265,167 H352L probably benign Het
Tnfsf8 A G 4: 63,834,115 S238P probably damaging Het
Tnn C T 1: 160,118,483 G922R probably damaging Het
Trhde A G 10: 114,486,704 probably null Het
Ttc6 A G 12: 57,660,291 I661M probably benign Het
Vmn1r209 T A 13: 22,805,807 M238L probably damaging Het
Vmn2r29 A G 7: 7,231,446 S814P probably damaging Het
Vsig10 T C 5: 117,348,370 L448P probably damaging Het
Xpo1 T G 11: 23,280,603 probably null Het
Zfp616 A T 11: 74,083,900 K423* probably null Het
Other mutations in Tmem214
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01083:Tmem214 APN 5 30876093 missense probably benign 0.15
IGL02119:Tmem214 APN 5 30872746 missense probably benign 0.01
IGL02123:Tmem214 APN 5 30872746 missense probably benign 0.01
IGL02124:Tmem214 APN 5 30872746 missense probably benign 0.01
IGL02126:Tmem214 APN 5 30872746 missense probably benign 0.01
IGL02186:Tmem214 APN 5 30872746 missense probably benign 0.01
IGL02395:Tmem214 APN 5 30872746 missense probably benign 0.01
IGL02396:Tmem214 APN 5 30872746 missense probably benign 0.01
IGL02397:Tmem214 APN 5 30872746 missense probably benign 0.01
IGL02400:Tmem214 APN 5 30872746 missense probably benign 0.01
IGL02403:Tmem214 APN 5 30872746 missense probably benign 0.01
IGL02404:Tmem214 APN 5 30872746 missense probably benign 0.01
IGL02539:Tmem214 APN 5 30872746 missense probably benign 0.01
IGL02544:Tmem214 APN 5 30872746 missense probably benign 0.01
IGL02934:Tmem214 APN 5 30871544 missense probably benign 0.26
PIT4382001:Tmem214 UTSW 5 30871451 missense possibly damaging 0.89
R0501:Tmem214 UTSW 5 30872532 missense probably damaging 1.00
R0519:Tmem214 UTSW 5 30869668 start codon destroyed probably null 0.98
R0675:Tmem214 UTSW 5 30871825 missense possibly damaging 0.70
R1204:Tmem214 UTSW 5 30875790 missense probably damaging 0.97
R1616:Tmem214 UTSW 5 30871563 nonsense probably null
R2096:Tmem214 UTSW 5 30876370 missense probably damaging 1.00
R2219:Tmem214 UTSW 5 30873631 missense possibly damaging 0.72
R5635:Tmem214 UTSW 5 30871517 missense probably damaging 1.00
R6003:Tmem214 UTSW 5 30870724 missense possibly damaging 0.52
R6744:Tmem214 UTSW 5 30874028 missense probably damaging 1.00
R7208:Tmem214 UTSW 5 30870721 missense possibly damaging 0.52
R8155:Tmem214 UTSW 5 30871792 missense possibly damaging 0.56
Predicted Primers PCR Primer
(F):5'- TCAGCGTGGTCATCAGTTCC -3'
(R):5'- CTGACAAATTCTAGGGGAGCTAG -3'

Sequencing Primer
(F):5'- GGTCATCAGTTCCCTTTACAATAAG -3'
(R):5'- TTCCATGGATAAAATGAACACACGG -3'
Posted On2020-09-02