Incidental Mutation 'R8335:Mug2'
ID 644577
Institutional Source Beutler Lab
Gene Symbol Mug2
Ensembl Gene ENSMUSG00000030131
Gene Name murinoglobulin 2
Synonyms
MMRRC Submission 067863-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.053) question?
Stock # R8335 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 121983720-122062924 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 122017543 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Leucine at position 427 (M427L)
Ref Sequence ENSEMBL: ENSMUSP00000080469 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081777]
AlphaFold P28666
Predicted Effect probably benign
Transcript: ENSMUST00000081777
AA Change: M427L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000080469
Gene: ENSMUSG00000030131
AA Change: M427L

DomainStartEndE-ValueType
Pfam:A2M_N 128 221 3.5e-21 PFAM
A2M_N_2 449 599 1.05e-42 SMART
low complexity region 711 728 N/A INTRINSIC
A2M 740 830 7.16e-36 SMART
Pfam:Thiol-ester_cl 963 992 1e-18 PFAM
low complexity region 994 1005 N/A INTRINSIC
Pfam:A2M_comp 1012 1097 5.8e-34 PFAM
Pfam:A2M_comp 1093 1243 3e-47 PFAM
A2M_recep 1353 1440 1.85e-38 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 97% (33/34)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ccdc47 C G 11: 106,099,084 (GRCm39) E202D possibly damaging Het
Ccdc47 T C 11: 106,099,085 (GRCm39) E202G probably damaging Het
Depdc1a C A 3: 159,228,859 (GRCm39) P537Q probably damaging Het
Dync2h1 A T 9: 7,084,941 (GRCm39) M2816K probably benign Het
Gatb T C 3: 85,481,628 (GRCm39) probably null Het
Gm6356 A G 14: 6,971,838 (GRCm38) M99T probably benign Het
Ighv1-67 A C 12: 115,567,744 (GRCm39) V56G probably damaging Het
Il27ra A T 8: 84,766,130 (GRCm39) L218Q probably damaging Het
Madd G A 2: 91,000,584 (GRCm39) R494C probably damaging Het
Mfsd8 G A 3: 40,789,628 (GRCm39) R140C probably damaging Het
Mink1 C T 11: 70,500,401 (GRCm39) R784W probably damaging Het
Mttp C T 3: 137,808,973 (GRCm39) D697N possibly damaging Het
Or10ag57 A G 2: 87,218,204 (GRCm39) I52V probably benign Het
Or13l2 T C 3: 97,318,024 (GRCm39) N158D probably benign Het
Or4a67 G T 2: 88,598,117 (GRCm39) P181T probably damaging Het
Or8k3b T A 2: 86,520,512 (GRCm39) D269V probably benign Het
Paxip1 T C 5: 27,971,122 (GRCm39) H409R unknown Het
Pkp3 T C 7: 140,667,669 (GRCm39) I490T probably damaging Het
Plekhg4 G T 8: 106,102,848 (GRCm39) V236L probably damaging Het
Pm20d2 T C 4: 33,189,245 (GRCm39) S46G probably benign Het
Prss33 A G 17: 24,053,569 (GRCm39) probably null Het
Ptpn3 A T 4: 57,235,286 (GRCm39) L358I probably damaging Het
Pxdn A G 12: 30,052,096 (GRCm39) T758A probably damaging Het
Sall3 G A 18: 81,012,801 (GRCm39) R1212C probably benign Het
Sox6 G A 7: 115,300,949 (GRCm39) L173F probably damaging Het
Spata20 T C 11: 94,373,369 (GRCm39) K501E probably benign Het
Stat2 G A 10: 128,112,452 (GRCm39) V31I possibly damaging Het
Synpo2 T A 3: 122,908,183 (GRCm39) N378Y probably damaging Het
Tacr2 A T 10: 62,100,946 (GRCm39) H352L probably benign Het
Tmem214 A G 5: 31,029,466 (GRCm39) K230E possibly damaging Het
Tnfsf8 A G 4: 63,752,352 (GRCm39) S238P probably damaging Het
Tnn C T 1: 159,946,053 (GRCm39) G922R probably damaging Het
Trhde A G 10: 114,322,609 (GRCm39) probably null Het
Ttc6 A G 12: 57,707,077 (GRCm39) I661M probably benign Het
Vmn1r209 T A 13: 22,989,977 (GRCm39) M238L probably damaging Het
Vmn2r29 A G 7: 7,234,445 (GRCm39) S814P probably damaging Het
Vsig10 T C 5: 117,486,435 (GRCm39) L448P probably damaging Het
Xpo1 T G 11: 23,230,603 (GRCm39) probably null Het
Zfp616 A T 11: 73,974,726 (GRCm39) K423* probably null Het
Other mutations in Mug2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00708:Mug2 APN 6 122,024,446 (GRCm39) missense possibly damaging 0.83
IGL00957:Mug2 APN 6 122,017,613 (GRCm39) missense probably damaging 0.99
IGL01314:Mug2 APN 6 122,058,238 (GRCm39) missense possibly damaging 0.62
IGL01338:Mug2 APN 6 122,026,587 (GRCm39) splice site probably benign
IGL01477:Mug2 APN 6 122,058,643 (GRCm39) splice site probably benign
IGL01926:Mug2 APN 6 122,013,063 (GRCm39) splice site probably benign
IGL02019:Mug2 APN 6 122,024,394 (GRCm39) missense probably benign 0.02
IGL02305:Mug2 APN 6 122,013,015 (GRCm39) missense probably benign
IGL02310:Mug2 APN 6 122,036,082 (GRCm39) splice site probably benign
IGL02484:Mug2 APN 6 122,049,712 (GRCm39) missense probably damaging 1.00
IGL02516:Mug2 APN 6 122,047,802 (GRCm39) missense probably damaging 1.00
IGL02531:Mug2 APN 6 122,049,730 (GRCm39) missense probably damaging 1.00
IGL02666:Mug2 APN 6 122,058,285 (GRCm39) missense probably damaging 1.00
IGL02936:Mug2 APN 6 122,058,346 (GRCm39) critical splice donor site probably null
R0114:Mug2 UTSW 6 122,017,607 (GRCm39) missense probably damaging 1.00
R0119:Mug2 UTSW 6 122,013,022 (GRCm39) missense probably benign 0.00
R0123:Mug2 UTSW 6 122,051,673 (GRCm39) missense possibly damaging 0.89
R0144:Mug2 UTSW 6 122,047,970 (GRCm39) splice site probably benign
R0225:Mug2 UTSW 6 122,051,673 (GRCm39) missense possibly damaging 0.89
R0514:Mug2 UTSW 6 122,058,558 (GRCm39) missense probably damaging 1.00
R0763:Mug2 UTSW 6 122,052,253 (GRCm39) missense probably benign
R0959:Mug2 UTSW 6 122,062,454 (GRCm39) missense probably benign 0.33
R1104:Mug2 UTSW 6 122,036,014 (GRCm39) missense probably benign
R1239:Mug2 UTSW 6 122,058,637 (GRCm39) splice site probably benign
R1318:Mug2 UTSW 6 122,054,361 (GRCm39) missense probably damaging 1.00
R1460:Mug2 UTSW 6 122,017,492 (GRCm39) splice site probably benign
R1706:Mug2 UTSW 6 122,013,191 (GRCm39) splice site probably benign
R1761:Mug2 UTSW 6 122,051,664 (GRCm39) missense probably benign 0.20
R1901:Mug2 UTSW 6 122,048,801 (GRCm39) missense probably benign 0.02
R1913:Mug2 UTSW 6 122,047,829 (GRCm39) missense probably damaging 1.00
R1943:Mug2 UTSW 6 122,056,598 (GRCm39) missense probably benign
R2054:Mug2 UTSW 6 122,054,451 (GRCm39) missense probably damaging 1.00
R2060:Mug2 UTSW 6 122,056,571 (GRCm39) missense probably benign
R2420:Mug2 UTSW 6 122,060,419 (GRCm39) missense probably damaging 1.00
R2432:Mug2 UTSW 6 122,061,335 (GRCm39) missense possibly damaging 0.93
R2916:Mug2 UTSW 6 122,051,683 (GRCm39) splice site probably null
R2918:Mug2 UTSW 6 122,051,683 (GRCm39) splice site probably null
R3423:Mug2 UTSW 6 122,024,465 (GRCm39) splice site probably benign
R3834:Mug2 UTSW 6 122,026,746 (GRCm39) critical splice donor site probably null
R3902:Mug2 UTSW 6 122,052,526 (GRCm39) missense probably damaging 1.00
R3941:Mug2 UTSW 6 122,040,522 (GRCm39) missense probably benign
R4227:Mug2 UTSW 6 122,017,691 (GRCm39) missense probably benign 0.10
R4284:Mug2 UTSW 6 122,040,632 (GRCm39) missense probably benign 0.00
R4287:Mug2 UTSW 6 122,040,632 (GRCm39) missense probably benign 0.00
R4377:Mug2 UTSW 6 122,047,966 (GRCm39) critical splice donor site probably null
R4419:Mug2 UTSW 6 122,056,589 (GRCm39) missense probably damaging 1.00
R4498:Mug2 UTSW 6 122,059,711 (GRCm39) missense probably damaging 0.99
R4566:Mug2 UTSW 6 122,056,597 (GRCm39) missense probably benign 0.00
R4690:Mug2 UTSW 6 122,013,255 (GRCm39) missense probably benign
R4732:Mug2 UTSW 6 122,048,831 (GRCm39) missense probably damaging 0.99
R4733:Mug2 UTSW 6 122,048,831 (GRCm39) missense probably damaging 0.99
R4741:Mug2 UTSW 6 122,056,572 (GRCm39) missense probably benign
R4888:Mug2 UTSW 6 122,058,154 (GRCm39) missense probably damaging 1.00
R5199:Mug2 UTSW 6 122,017,619 (GRCm39) missense probably benign
R5347:Mug2 UTSW 6 122,058,551 (GRCm39) missense probably damaging 1.00
R5457:Mug2 UTSW 6 122,026,688 (GRCm39) nonsense probably null
R5495:Mug2 UTSW 6 122,056,609 (GRCm39) missense probably damaging 0.96
R5509:Mug2 UTSW 6 122,061,340 (GRCm39) missense possibly damaging 0.84
R6006:Mug2 UTSW 6 122,060,459 (GRCm39) missense probably null 0.98
R6180:Mug2 UTSW 6 122,056,565 (GRCm39) missense probably benign 0.01
R6184:Mug2 UTSW 6 122,014,005 (GRCm39) missense probably benign
R6199:Mug2 UTSW 6 122,024,398 (GRCm39) missense probably benign 0.05
R6262:Mug2 UTSW 6 122,052,214 (GRCm39) missense probably damaging 1.00
R6416:Mug2 UTSW 6 122,059,713 (GRCm39) missense probably damaging 1.00
R6548:Mug2 UTSW 6 122,024,401 (GRCm39) missense probably damaging 1.00
R6703:Mug2 UTSW 6 122,055,653 (GRCm39) missense probably benign 0.25
R7106:Mug2 UTSW 6 122,059,680 (GRCm39) missense probably damaging 1.00
R7131:Mug2 UTSW 6 122,052,206 (GRCm39) missense probably damaging 1.00
R7372:Mug2 UTSW 6 122,060,425 (GRCm39) missense possibly damaging 0.88
R7379:Mug2 UTSW 6 122,024,446 (GRCm39) missense possibly damaging 0.83
R7419:Mug2 UTSW 6 122,017,529 (GRCm39) missense possibly damaging 0.86
R7423:Mug2 UTSW 6 122,056,685 (GRCm39) missense probably benign 0.00
R7581:Mug2 UTSW 6 122,040,670 (GRCm39) missense probably damaging 1.00
R7582:Mug2 UTSW 6 122,056,603 (GRCm39) missense probably damaging 0.99
R7672:Mug2 UTSW 6 122,017,678 (GRCm39) missense probably benign 0.37
R7713:Mug2 UTSW 6 122,055,754 (GRCm39) missense possibly damaging 0.83
R7759:Mug2 UTSW 6 122,058,317 (GRCm39) missense probably damaging 1.00
R7834:Mug2 UTSW 6 122,013,241 (GRCm39) missense probably benign
R7850:Mug2 UTSW 6 122,052,170 (GRCm39) missense probably damaging 1.00
R8029:Mug2 UTSW 6 122,058,504 (GRCm39) critical splice acceptor site probably null
R8127:Mug2 UTSW 6 122,052,567 (GRCm39) missense probably benign 0.01
R8348:Mug2 UTSW 6 122,049,192 (GRCm39) nonsense probably null
R8557:Mug2 UTSW 6 122,040,660 (GRCm39) missense probably damaging 0.99
R8798:Mug2 UTSW 6 122,058,569 (GRCm39) missense probably damaging 1.00
R8823:Mug2 UTSW 6 122,040,648 (GRCm39) missense possibly damaging 0.89
R9029:Mug2 UTSW 6 122,061,328 (GRCm39) missense probably damaging 1.00
R9153:Mug2 UTSW 6 122,017,627 (GRCm39) missense possibly damaging 0.71
R9185:Mug2 UTSW 6 122,054,442 (GRCm39) missense probably benign 0.06
R9186:Mug2 UTSW 6 122,052,248 (GRCm39) missense probably damaging 0.99
R9418:Mug2 UTSW 6 122,017,700 (GRCm39) missense probably benign 0.00
R9464:Mug2 UTSW 6 122,028,690 (GRCm39) missense probably benign 0.01
R9622:Mug2 UTSW 6 122,028,751 (GRCm39) missense probably benign 0.29
Z1177:Mug2 UTSW 6 122,014,080 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCAGGGTGTTAGACATCAATCC -3'
(R):5'- ACTCACCAGGTAGTAGAAAACG -3'

Sequencing Primer
(F):5'- GGTGTTAGACATCAATCCATCTAATG -3'
(R):5'- CCAGGTAGTAGAAAACGAGCTCTTTC -3'
Posted On 2020-09-02