Incidental Mutation 'R0070:Tusc3'
List |< first << previous [record 63 of 69] next >> last >|
ID64459
Institutional Source Beutler Lab
Gene Symbol Tusc3
Ensembl Gene ENSMUSG00000039530
Gene Nametumor suppressor candidate 3
Synonyms
MMRRC Submission 038361-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.702) question?
Stock #R0070 (G1)
Quality Score168
Status Validated
Chromosome8
Chromosomal Location39005845-39165114 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 39063267 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 129 (G129R)
Ref Sequence ENSEMBL: ENSMUSP00000148134 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000167992] [ENSMUST00000169034] [ENSMUST00000209440] [ENSMUST00000211241]
Predicted Effect possibly damaging
Transcript: ENSMUST00000167992
AA Change: G129R

PolyPhen 2 Score 0.491 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000126080
Gene: ENSMUSG00000039530
AA Change: G129R

DomainStartEndE-ValueType
signal peptide 1 41 N/A INTRINSIC
Pfam:Thioredoxin 64 185 3.7e-7 PFAM
Pfam:OST3_OST6 179 329 1.6e-63 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169034
SMART Domains Protein: ENSMUSP00000129916
Gene: ENSMUSG00000039530

DomainStartEndE-ValueType
signal peptide 1 41 N/A INTRINSIC
PDB:4M90|A 44 102 7e-38 PDB
Predicted Effect possibly damaging
Transcript: ENSMUST00000209440
AA Change: G129R

PolyPhen 2 Score 0.491 (Sensitivity: 0.88; Specificity: 0.90)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209970
Predicted Effect unknown
Transcript: ENSMUST00000210890
AA Change: G59R
Predicted Effect probably benign
Transcript: ENSMUST00000211241
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 96.1%
Validation Efficiency 97% (68/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a candidate tumor suppressor gene. It is located within a homozygously deleted region of a metastatic prostate cancer. The gene is expressed in most nonlymphoid human tissues including prostate, lung, liver, and colon. Expression was also detected in many epithelial tumor cell lines. Two transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgre4 T C 17: 55,802,154 I387T probably damaging Het
Alpi A G 1: 87,101,159 probably benign Het
Ankfn1 A T 11: 89,392,302 L173Q probably damaging Het
Atp2a1 T C 7: 126,447,452 E892G probably benign Het
AU018091 T C 7: 3,158,898 probably null Het
Capn12 T C 7: 28,889,126 probably benign Het
Capn2 C A 1: 182,473,869 probably benign Het
Cd79b A G 11: 106,311,918 probably benign Het
Cdh7 C T 1: 110,098,372 A446V probably benign Het
Ciapin1 T C 8: 94,825,219 N246S possibly damaging Het
Cmip T A 8: 117,426,554 I270N probably damaging Het
Cyp2d40 A G 15: 82,760,774 V225A unknown Het
Dnah9 A G 11: 66,160,040 V142A probably benign Het
Fam126a T C 5: 23,964,999 S451G probably damaging Het
Flt3 A G 5: 147,372,726 probably benign Het
Gm10238 A G 15: 75,237,585 noncoding transcript Het
Gm4787 T A 12: 81,379,066 D106V probably damaging Het
Hipk2 G A 6: 38,818,984 R117* probably null Het
Ifna11 A G 4: 88,820,275 D106G possibly damaging Het
Igkv1-115 G A 6: 68,161,418 V2I probably benign Het
Itga6 T C 2: 71,826,716 probably benign Het
Kcnj6 C A 16: 94,941,197 K5N probably benign Het
Kcnt1 T C 2: 25,892,362 V191A probably benign Het
Lcorl G A 5: 45,733,701 R437C probably damaging Het
Man2a1 G A 17: 64,659,079 probably null Het
Map3k14 T A 11: 103,239,554 probably null Het
Mtch1 T A 17: 29,340,059 probably benign Het
Myo1c A G 11: 75,660,250 N217S probably benign Het
Olfr132 A G 17: 38,130,889 L101P probably damaging Het
Olfr1362 T C 13: 21,611,261 K236R possibly damaging Het
Orm3 A G 4: 63,356,646 T64A probably benign Het
Phf20l1 T G 15: 66,639,991 W940G probably damaging Het
Phldb1 C T 9: 44,707,904 R844H probably damaging Het
Piezo2 T C 18: 63,102,084 D814G probably damaging Het
Pkd2 T C 5: 104,466,990 C233R probably damaging Het
Prkd3 A G 17: 78,954,510 Y792H probably damaging Het
Pth1r A T 9: 110,727,550 probably null Het
Pxdn T C 12: 29,982,727 L146S probably damaging Het
Rnf32 A G 5: 29,225,127 T315A probably benign Het
Rpl5 T C 5: 107,901,900 Y12H probably benign Het
Serpinh1 A T 7: 99,349,314 S36R probably damaging Het
Setx A T 2: 29,161,525 T2030S probably benign Het
Sf3a3 G A 4: 124,714,955 V21I probably benign Het
Sin3b T A 8: 72,725,582 H105Q probably damaging Het
Slitrk1 T C 14: 108,913,317 probably benign Het
Slx4 A T 16: 3,988,016 D557E possibly damaging Het
Sprr3 C T 3: 92,457,302 M78I probably benign Het
Ssmem1 A G 6: 30,519,421 E35G possibly damaging Het
Stag1 C T 9: 100,956,408 P1238S probably null Het
Stra6 C T 9: 58,152,615 probably benign Het
Tmem127 T C 2: 127,257,059 V171A probably damaging Het
Tmem150a A G 6: 72,358,759 probably null Het
Top2a C G 11: 99,015,060 probably null Het
Ttn T C 2: 76,814,427 probably null Het
Uspl1 A G 5: 149,209,705 Y422C probably damaging Het
Vmn2r88 A T 14: 51,414,140 T312S probably benign Het
Wdr78 A T 4: 103,059,934 I571K probably damaging Het
Zc3hav1l A T 6: 38,295,190 S215T probably damaging Het
Zfp947 T A 17: 22,146,184 T170S probably benign Het
Other mutations in Tusc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01730:Tusc3 APN 8 39164839 makesense probably null
IGL03247:Tusc3 APN 8 39130777 missense possibly damaging 0.64
R0594:Tusc3 UTSW 8 39096968 missense probably damaging 1.00
R1648:Tusc3 UTSW 8 39046567 nonsense probably null
R3615:Tusc3 UTSW 8 39164838 missense probably damaging 0.97
R3616:Tusc3 UTSW 8 39164838 missense probably damaging 0.97
R5502:Tusc3 UTSW 8 39130793 nonsense probably null
R5723:Tusc3 UTSW 8 39071497 missense possibly damaging 0.75
R5753:Tusc3 UTSW 8 39096946 missense probably damaging 1.00
R6004:Tusc3 UTSW 8 39071406 missense probably damaging 0.99
R6030:Tusc3 UTSW 8 39071406 missense probably damaging 0.99
R6030:Tusc3 UTSW 8 39071406 missense probably damaging 0.99
R7162:Tusc3 UTSW 8 39126587 missense probably benign 0.00
R7483:Tusc3 UTSW 8 39071481 missense probably benign 0.01
R8309:Tusc3 UTSW 8 39164841 makesense probably null
Predicted Primers PCR Primer
(F):5'- ACTACCCCAGAGTTGCCTGTTGT -3'
(R):5'- AAGCCCGTGTGAAATACTACCTAAGC -3'

Sequencing Primer
(F):5'- TATCTGTTCCAGGCAGGCTA -3'
(R):5'- acctcctccacctcccc -3'
Posted On2013-08-06