Incidental Mutation 'R8335:Pxdn'
ID644592
Institutional Source Beutler Lab
Gene Symbol Pxdn
Ensembl Gene ENSMUSG00000020674
Gene Nameperoxidasin
SynonymsVPO1, 2310075M15Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.600) question?
Stock #R8335 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location29937608-30017658 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 30002097 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 758 (T758A)
Ref Sequence ENSEMBL: ENSMUSP00000113703 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000122328] [ENSMUST00000220271]
Predicted Effect probably damaging
Transcript: ENSMUST00000122328
AA Change: T758A

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000113703
Gene: ENSMUSG00000020674
AA Change: T758A

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
LRRNT 32 63 2.52e-1 SMART
LRR 62 81 4.09e1 SMART
LRR_TYP 82 105 3.69e-4 SMART
LRR_TYP 106 129 1.45e-2 SMART
LRR_TYP 130 153 8.02e-5 SMART
LRR_TYP 154 177 1.06e-4 SMART
LRRCT 189 241 3.97e-5 SMART
IGc2 255 321 1.59e-15 SMART
IGc2 351 416 3.96e-16 SMART
IGc2 442 506 2.96e-15 SMART
IGc2 534 598 1.2e-15 SMART
Pfam:An_peroxidase 738 1286 1.1e-196 PFAM
VWC 1411 1466 8.8e-15 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000220271
AA Change: T578A

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 97% (33/34)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a heme-containing peroxidase that is secreted into the extracellular matrix. It is involved in extracellular matrix formation, and may function in the physiological and pathological fibrogenic response in fibrotic kidney. Mutations in this gene cause corneal opacification and other ocular anomalies, and also microphthalmia and anterior segment dysgenesis. [provided by RefSeq, Aug 2014]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit abnormal eye development with early-onset glaucoma and progressive retinal dysgenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ccdc47 C G 11: 106,208,258 E202D possibly damaging Het
Ccdc47 T C 11: 106,208,259 E202G probably damaging Het
Depdc1a C A 3: 159,523,222 P537Q probably damaging Het
Dync2h1 A T 9: 7,084,941 M2816K probably benign Het
Gatb T C 3: 85,574,321 probably null Het
Gm6356 A G 14: 6,971,838 M99T probably benign Het
Ighv1-67 A C 12: 115,604,124 V56G probably damaging Het
Il27ra A T 8: 84,039,501 L218Q probably damaging Het
Madd G A 2: 91,170,239 R494C probably damaging Het
Mfsd8 G A 3: 40,835,193 R140C probably damaging Het
Mink1 C T 11: 70,609,575 R784W probably damaging Het
Mttp C T 3: 138,103,212 D697N possibly damaging Het
Mug2 A T 6: 122,040,584 M427L probably benign Het
Olfr1087 T A 2: 86,690,168 D269V probably benign Het
Olfr1122 A G 2: 87,387,860 I52V probably benign Het
Olfr1200 G T 2: 88,767,773 P181T probably damaging Het
Olfr1402 T C 3: 97,410,708 N158D probably benign Het
Paxip1 T C 5: 27,766,124 H409R unknown Het
Pkp3 T C 7: 141,087,756 I490T probably damaging Het
Plekhg4 G T 8: 105,376,216 V236L probably damaging Het
Pm20d2 T C 4: 33,189,245 S46G probably benign Het
Prss33 A G 17: 23,834,595 probably null Het
Ptpn3 A T 4: 57,235,286 L358I probably damaging Het
Sall3 G A 18: 80,969,586 R1212C probably benign Het
Sox6 G A 7: 115,701,714 L173F probably damaging Het
Spata20 T C 11: 94,482,543 K501E probably benign Het
Stat2 G A 10: 128,276,583 V31I possibly damaging Het
Synpo2 T A 3: 123,114,534 N378Y probably damaging Het
Tacr2 A T 10: 62,265,167 H352L probably benign Het
Tmem214 A G 5: 30,872,122 K230E possibly damaging Het
Tnfsf8 A G 4: 63,834,115 S238P probably damaging Het
Tnn C T 1: 160,118,483 G922R probably damaging Het
Trhde A G 10: 114,486,704 probably null Het
Ttc6 A G 12: 57,660,291 I661M probably benign Het
Vmn1r209 T A 13: 22,805,807 M238L probably damaging Het
Vmn2r29 A G 7: 7,231,446 S814P probably damaging Het
Vsig10 T C 5: 117,348,370 L448P probably damaging Het
Xpo1 T G 11: 23,280,603 probably null Het
Zfp616 A T 11: 74,083,900 K423* probably null Het
Other mutations in Pxdn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01024:Pxdn APN 12 29987099 missense probably damaging 1.00
IGL01152:Pxdn APN 12 30001937 missense probably damaging 0.99
IGL01286:Pxdn APN 12 29982754 missense probably benign 0.04
IGL01323:Pxdn APN 12 29987137 missense probably benign 0.00
IGL01338:Pxdn APN 12 30002797 missense probably damaging 1.00
IGL01341:Pxdn APN 12 30002487 missense probably damaging 1.00
IGL01401:Pxdn APN 12 30001984 missense probably damaging 1.00
IGL01580:Pxdn APN 12 29984493 missense probably benign 0.18
IGL01650:Pxdn APN 12 30002401 missense probably benign 0.01
IGL01679:Pxdn APN 12 29999902 missense probably damaging 0.97
IGL01866:Pxdn APN 12 29984571 missense probably benign 0.02
IGL02354:Pxdn APN 12 29999189 missense probably damaging 1.00
IGL02361:Pxdn APN 12 29999189 missense probably damaging 1.00
IGL02427:Pxdn APN 12 29984532 missense probably damaging 1.00
IGL02955:Pxdn APN 12 30003157 missense probably damaging 1.00
IGL03079:Pxdn APN 12 30002998 missense probably damaging 0.97
IGL03111:Pxdn APN 12 29982756 missense probably damaging 0.99
IGL02988:Pxdn UTSW 12 30003114 nonsense probably null
PIT4280001:Pxdn UTSW 12 29995328 missense probably damaging 0.99
PIT4469001:Pxdn UTSW 12 30005829 missense probably benign 0.00
R0070:Pxdn UTSW 12 29982727 missense probably damaging 0.99
R0070:Pxdn UTSW 12 29982727 missense probably damaging 0.99
R0086:Pxdn UTSW 12 30002419 missense possibly damaging 0.95
R0140:Pxdn UTSW 12 29982754 missense probably benign 0.04
R0201:Pxdn UTSW 12 30002431 missense possibly damaging 0.79
R0282:Pxdn UTSW 12 29984440 nonsense probably null
R0310:Pxdn UTSW 12 30015529 missense probably damaging 1.00
R0426:Pxdn UTSW 12 29987066 missense possibly damaging 0.89
R0468:Pxdn UTSW 12 29994486 missense probably damaging 0.99
R0825:Pxdn UTSW 12 29984996 splice site probably benign
R0885:Pxdn UTSW 12 30003402 missense probably benign 0.30
R1420:Pxdn UTSW 12 30002068 missense probably damaging 1.00
R1588:Pxdn UTSW 12 30002559 missense probably damaging 1.00
R2269:Pxdn UTSW 12 30005775 missense probably damaging 0.97
R2280:Pxdn UTSW 12 29984906 missense probably damaging 0.98
R2504:Pxdn UTSW 12 30003406 missense probably damaging 1.00
R2679:Pxdn UTSW 12 29975569 splice site probably benign
R3116:Pxdn UTSW 12 30002307 missense possibly damaging 0.89
R3607:Pxdn UTSW 12 29990918 missense probably benign 0.04
R4033:Pxdn UTSW 12 30003225 missense probably benign 0.19
R4576:Pxdn UTSW 12 30011923 missense probably benign
R4659:Pxdn UTSW 12 29994553 missense probably benign 0.01
R4681:Pxdn UTSW 12 30012326 missense probably benign 0.45
R4968:Pxdn UTSW 12 30000012 missense probably benign 0.25
R5032:Pxdn UTSW 12 30003141 missense probably benign 0.08
R5232:Pxdn UTSW 12 29990988 missense probably benign 0.08
R5366:Pxdn UTSW 12 30002900 missense probably damaging 1.00
R5504:Pxdn UTSW 12 30002801 missense probably damaging 1.00
R5586:Pxdn UTSW 12 30003142 missense probably damaging 0.99
R5739:Pxdn UTSW 12 29982334 missense probably benign 0.03
R5877:Pxdn UTSW 12 30003046 missense probably damaging 1.00
R6167:Pxdn UTSW 12 29974001 missense probably damaging 1.00
R6191:Pxdn UTSW 12 29982717 missense possibly damaging 0.94
R6200:Pxdn UTSW 12 30003112 missense probably damaging 1.00
R6609:Pxdn UTSW 12 30002941 missense probably benign 0.00
R6628:Pxdn UTSW 12 29999918 missense probably damaging 1.00
R6865:Pxdn UTSW 12 30014583 splice site probably null
R6921:Pxdn UTSW 12 30015505 missense probably damaging 0.96
R6995:Pxdn UTSW 12 29995371 missense possibly damaging 0.95
R7211:Pxdn UTSW 12 29984904 missense possibly damaging 0.77
R7220:Pxdn UTSW 12 29994480 missense probably benign 0.02
R7347:Pxdn UTSW 12 30012261 missense probably benign 0.01
R7402:Pxdn UTSW 12 30002439 missense probably damaging 1.00
R7408:Pxdn UTSW 12 29990945 missense probably benign 0.29
R7413:Pxdn UTSW 12 30002928 missense probably benign 0.00
R7447:Pxdn UTSW 12 29984927 missense probably damaging 1.00
R7572:Pxdn UTSW 12 30006705 missense probably damaging 1.00
R7708:Pxdn UTSW 12 30006602 missense probably damaging 0.99
R7815:Pxdn UTSW 12 30005825 missense probably damaging 0.96
R7972:Pxdn UTSW 12 30006602 missense probably damaging 0.99
R8097:Pxdn UTSW 12 30006602 missense probably damaging 0.99
R8098:Pxdn UTSW 12 30006602 missense probably damaging 0.99
R8205:Pxdn UTSW 12 30006567 missense probably damaging 1.00
R8262:Pxdn UTSW 12 29999196 nonsense probably null
R8356:Pxdn UTSW 12 30011890 missense probably damaging 0.99
R8437:Pxdn UTSW 12 30002044 missense probably damaging 1.00
R8456:Pxdn UTSW 12 30011890 missense probably damaging 0.99
R8709:Pxdn UTSW 12 30006602 missense probably damaging 0.99
R8772:Pxdn UTSW 12 30015464 missense probably damaging 1.00
Z1177:Pxdn UTSW 12 29990852 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTCTGAAGGCAGTGGTCTG -3'
(R):5'- TGTGTGTAAACTGCTCATCGG -3'

Sequencing Primer
(F):5'- TGCAGGTTACCACTACAATGATCTGG -3'
(R):5'- AAACTGCTCATCGGGGGTGATC -3'
Posted On2020-09-02