Incidental Mutation 'R8335:Vmn1r209'
ID644595
Institutional Source Beutler Lab
Gene Symbol Vmn1r209
Ensembl Gene ENSMUSG00000071491
Gene Namevomeronasal 1 receptor 209
SynonymsGm11315
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.111) question?
Stock #R8335 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location22800629-22809682 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 22805807 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 238 (M238L)
Ref Sequence ENSEMBL: ENSMUSP00000093657 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095961] [ENSMUST00000227038] [ENSMUST00000227265]
Predicted Effect probably damaging
Transcript: ENSMUST00000095961
AA Change: M238L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000093657
Gene: ENSMUSG00000071491
AA Change: M238L

DomainStartEndE-ValueType
Pfam:TAS2R 2 294 9.8e-9 PFAM
Pfam:V1R 34 297 3e-36 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000227038
AA Change: M238L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect probably damaging
Transcript: ENSMUST00000227265
AA Change: M238L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ccdc47 C G 11: 106,208,258 E202D possibly damaging Het
Ccdc47 T C 11: 106,208,259 E202G probably damaging Het
Depdc1a C A 3: 159,523,222 P537Q probably damaging Het
Dync2h1 A T 9: 7,084,941 M2816K probably benign Het
Gatb T C 3: 85,574,321 probably null Het
Gm6356 A G 14: 6,971,838 M99T probably benign Het
Ighv1-67 A C 12: 115,604,124 V56G probably damaging Het
Il27ra A T 8: 84,039,501 L218Q probably damaging Het
Madd G A 2: 91,170,239 R494C probably damaging Het
Mfsd8 G A 3: 40,835,193 R140C probably damaging Het
Mink1 C T 11: 70,609,575 R784W probably damaging Het
Mttp C T 3: 138,103,212 D697N possibly damaging Het
Mug2 A T 6: 122,040,584 M427L probably benign Het
Olfr1087 T A 2: 86,690,168 D269V probably benign Het
Olfr1122 A G 2: 87,387,860 I52V probably benign Het
Olfr1200 G T 2: 88,767,773 P181T probably damaging Het
Olfr1402 T C 3: 97,410,708 N158D probably benign Het
Paxip1 T C 5: 27,766,124 H409R unknown Het
Pkp3 T C 7: 141,087,756 I490T probably damaging Het
Plekhg4 G T 8: 105,376,216 V236L probably damaging Het
Pm20d2 T C 4: 33,189,245 S46G probably benign Het
Prss33 A G 17: 23,834,595 probably null Het
Ptpn3 A T 4: 57,235,286 L358I probably damaging Het
Pxdn A G 12: 30,002,097 T758A probably damaging Het
Sall3 G A 18: 80,969,586 R1212C probably benign Het
Sox6 G A 7: 115,701,714 L173F probably damaging Het
Spata20 T C 11: 94,482,543 K501E probably benign Het
Stat2 G A 10: 128,276,583 V31I possibly damaging Het
Synpo2 T A 3: 123,114,534 N378Y probably damaging Het
Tacr2 A T 10: 62,265,167 H352L probably benign Het
Tmem214 A G 5: 30,872,122 K230E possibly damaging Het
Tnfsf8 A G 4: 63,834,115 S238P probably damaging Het
Tnn C T 1: 160,118,483 G922R probably damaging Het
Trhde A G 10: 114,486,704 probably null Het
Ttc6 A G 12: 57,660,291 I661M probably benign Het
Vmn2r29 A G 7: 7,231,446 S814P probably damaging Het
Vsig10 T C 5: 117,348,370 L448P probably damaging Het
Zfp616 A T 11: 74,083,900 K423* probably null Het
Other mutations in Vmn1r209
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01773:Vmn1r209 APN 13 22806280 missense probably damaging 1.00
IGL01788:Vmn1r209 APN 13 22805662 missense probably damaging 0.97
IGL02738:Vmn1r209 APN 13 22806120 nonsense probably null
IGL03177:Vmn1r209 APN 13 22805854 missense possibly damaging 0.46
IGL03199:Vmn1r209 APN 13 22806050 missense possibly damaging 0.89
R0437:Vmn1r209 UTSW 13 22806356 missense probably benign 0.01
R0497:Vmn1r209 UTSW 13 22805948 missense probably damaging 1.00
R0506:Vmn1r209 UTSW 13 22805944 missense probably damaging 0.98
R1496:Vmn1r209 UTSW 13 22805764 missense probably damaging 1.00
R1644:Vmn1r209 UTSW 13 22806482 missense possibly damaging 0.52
R1829:Vmn1r209 UTSW 13 22806239 missense possibly damaging 0.95
R2360:Vmn1r209 UTSW 13 22805666 missense probably damaging 1.00
R3434:Vmn1r209 UTSW 13 22806097 missense probably benign 0.04
R3435:Vmn1r209 UTSW 13 22806097 missense probably benign 0.04
R4082:Vmn1r209 UTSW 13 22805615 missense probably null 0.15
R4451:Vmn1r209 UTSW 13 22806498 missense probably benign 0.02
R4616:Vmn1r209 UTSW 13 22805965 missense probably damaging 1.00
R4618:Vmn1r209 UTSW 13 22806449 missense possibly damaging 0.87
R4801:Vmn1r209 UTSW 13 22805656 missense probably damaging 1.00
R4802:Vmn1r209 UTSW 13 22805656 missense probably damaging 1.00
R6035:Vmn1r209 UTSW 13 22806032 missense probably benign 0.02
R6035:Vmn1r209 UTSW 13 22806032 missense probably benign 0.02
R6908:Vmn1r209 UTSW 13 22806230 missense possibly damaging 0.60
R7162:Vmn1r209 UTSW 13 22805958 missense probably damaging 1.00
R7772:Vmn1r209 UTSW 13 22806494 missense possibly damaging 0.77
R8328:Vmn1r209 UTSW 13 22806473 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGAGCATGCCAACATTCAAC -3'
(R):5'- CAGATCTGAATATGTCACAGCG -3'

Sequencing Primer
(F):5'- CCAGAAGCCCATCCCTGTG -3'
(R):5'- GAATGGATATTTCTCACTCTCATGG -3'
Posted On2020-09-02