Incidental Mutation 'R0070:Ciapin1'
ID64460
Institutional Source Beutler Lab
Gene Symbol Ciapin1
Ensembl Gene ENSMUSG00000031781
Gene Namecytokine induced apoptosis inhibitor 1
Synonymsanamorsin, 2810413N20Rik
MMRRC Submission 038361-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0070 (G1)
Quality Score85
Status Validated
Chromosome8
Chromosomal Location94819804-94838358 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 94825219 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 246 (N246S)
Ref Sequence ENSEMBL: ENSMUSP00000125451 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034233] [ENSMUST00000161792] [ENSMUST00000162538]
Predicted Effect possibly damaging
Transcript: ENSMUST00000034233
AA Change: N246S

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000034233
Gene: ENSMUSG00000031781
AA Change: N246S

DomainStartEndE-ValueType
Pfam:Methyltransf_11 18 95 4.7e-6 PFAM
Pfam:CIAPIN1 228 270 8e-8 PFAM
Pfam:CIAPIN1 262 301 3.3e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160245
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160301
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160898
Predicted Effect probably benign
Transcript: ENSMUST00000161762
SMART Domains Protein: ENSMUSP00000123794
Gene: ENSMUSG00000031781

DomainStartEndE-ValueType
PDB:2LD4|A 1 171 9e-95 PDB
SCOP:d1khha_ 8 146 2e-7 SMART
Predicted Effect unknown
Transcript: ENSMUST00000161792
AA Change: N191S
SMART Domains Protein: ENSMUSP00000125474
Gene: ENSMUSG00000031781
AA Change: N191S

DomainStartEndE-ValueType
PDB:2LD4|A 10 76 3e-31 PDB
Pfam:CIAPIN1 125 158 1.8e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162357
Predicted Effect possibly damaging
Transcript: ENSMUST00000162538
AA Change: N246S

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000125451
Gene: ENSMUSG00000031781
AA Change: N246S

DomainStartEndE-ValueType
Pfam:Methyltransf_11 18 95 4.7e-6 PFAM
Pfam:CIAPIN1 228 270 8e-8 PFAM
Pfam:CIAPIN1 262 301 3.3e-19 PFAM
Meta Mutation Damage Score 0.1990 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 96.1%
Validation Efficiency 97% (68/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] CIAPIN1 is a cytokine-induced inhibitor of apoptosis with no relation to apoptosis regulatory molecules of the BCL2 (MIM 151430) or CASP (see MIM 147678) families. Expression of CIAPIN1 is dependent on growth factor stimulation (Shibayama et al., 2004 [PubMed 14970183]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene die as embryos with erythropoietic abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgre4 T C 17: 55,802,154 I387T probably damaging Het
Alpi A G 1: 87,101,159 probably benign Het
Ankfn1 A T 11: 89,392,302 L173Q probably damaging Het
Atp2a1 T C 7: 126,447,452 E892G probably benign Het
AU018091 T C 7: 3,158,898 probably null Het
Capn12 T C 7: 28,889,126 probably benign Het
Capn2 C A 1: 182,473,869 probably benign Het
Cd79b A G 11: 106,311,918 probably benign Het
Cdh7 C T 1: 110,098,372 A446V probably benign Het
Cmip T A 8: 117,426,554 I270N probably damaging Het
Cyp2d40 A G 15: 82,760,774 V225A unknown Het
Dnah9 A G 11: 66,160,040 V142A probably benign Het
Fam126a T C 5: 23,964,999 S451G probably damaging Het
Flt3 A G 5: 147,372,726 probably benign Het
Gm10238 A G 15: 75,237,585 noncoding transcript Het
Gm4787 T A 12: 81,379,066 D106V probably damaging Het
Hipk2 G A 6: 38,818,984 R117* probably null Het
Ifna11 A G 4: 88,820,275 D106G possibly damaging Het
Igkv1-115 G A 6: 68,161,418 V2I probably benign Het
Itga6 T C 2: 71,826,716 probably benign Het
Kcnj6 C A 16: 94,941,197 K5N probably benign Het
Kcnt1 T C 2: 25,892,362 V191A probably benign Het
Lcorl G A 5: 45,733,701 R437C probably damaging Het
Man2a1 G A 17: 64,659,079 probably null Het
Map3k14 T A 11: 103,239,554 probably null Het
Mtch1 T A 17: 29,340,059 probably benign Het
Myo1c A G 11: 75,660,250 N217S probably benign Het
Olfr132 A G 17: 38,130,889 L101P probably damaging Het
Olfr1362 T C 13: 21,611,261 K236R possibly damaging Het
Orm3 A G 4: 63,356,646 T64A probably benign Het
Phf20l1 T G 15: 66,639,991 W940G probably damaging Het
Phldb1 C T 9: 44,707,904 R844H probably damaging Het
Piezo2 T C 18: 63,102,084 D814G probably damaging Het
Pkd2 T C 5: 104,466,990 C233R probably damaging Het
Prkd3 A G 17: 78,954,510 Y792H probably damaging Het
Pth1r A T 9: 110,727,550 probably null Het
Pxdn T C 12: 29,982,727 L146S probably damaging Het
Rnf32 A G 5: 29,225,127 T315A probably benign Het
Rpl5 T C 5: 107,901,900 Y12H probably benign Het
Serpinh1 A T 7: 99,349,314 S36R probably damaging Het
Setx A T 2: 29,161,525 T2030S probably benign Het
Sf3a3 G A 4: 124,714,955 V21I probably benign Het
Sin3b T A 8: 72,725,582 H105Q probably damaging Het
Slitrk1 T C 14: 108,913,317 probably benign Het
Slx4 A T 16: 3,988,016 D557E possibly damaging Het
Sprr3 C T 3: 92,457,302 M78I probably benign Het
Ssmem1 A G 6: 30,519,421 E35G possibly damaging Het
Stag1 C T 9: 100,956,408 P1238S probably null Het
Stra6 C T 9: 58,152,615 probably benign Het
Tmem127 T C 2: 127,257,059 V171A probably damaging Het
Tmem150a A G 6: 72,358,759 probably null Het
Top2a C G 11: 99,015,060 probably null Het
Ttn T C 2: 76,814,427 probably null Het
Tusc3 G A 8: 39,063,267 G129R possibly damaging Het
Uspl1 A G 5: 149,209,705 Y422C probably damaging Het
Vmn2r88 A T 14: 51,414,140 T312S probably benign Het
Wdr78 A T 4: 103,059,934 I571K probably damaging Het
Zc3hav1l A T 6: 38,295,190 S215T probably damaging Het
Zfp947 T A 17: 22,146,184 T170S probably benign Het
Other mutations in Ciapin1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0070:Ciapin1 UTSW 8 94825219 missense possibly damaging 0.91
R0218:Ciapin1 UTSW 8 94828310 missense probably damaging 0.98
R1980:Ciapin1 UTSW 8 94832533 missense probably benign 0.00
R2197:Ciapin1 UTSW 8 94829159 nonsense probably null
R2273:Ciapin1 UTSW 8 94831787 missense probably damaging 0.98
R4020:Ciapin1 UTSW 8 94829186 missense probably damaging 1.00
R5790:Ciapin1 UTSW 8 94825183 intron probably benign
R7236:Ciapin1 UTSW 8 94823710 missense
R8268:Ciapin1 UTSW 8 94831883 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAGACTTGCCCTGAGCAACCTTATC -3'
(R):5'- GTCAGCTTTTCATCAGAGGGACCG -3'

Sequencing Primer
(F):5'- tccacttgcttctgcctc -3'
(R):5'- GTGGCTGTGTTGCTAAGTG -3'
Posted On2013-08-06