Incidental Mutation 'R8336:Pabpc1l'
ID644606
Institutional Source Beutler Lab
Gene Symbol Pabpc1l
Ensembl Gene ENSMUSG00000054582
Gene Namepoly(A) binding protein, cytoplasmic 1-like
Synonyms1810053B01Rik, ePAB
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8336 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location164025450-164050538 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 164032284 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 203 (D203G)
Ref Sequence ENSEMBL: ENSMUSP00000096701 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067715]
Predicted Effect probably benign
Transcript: ENSMUST00000067715
AA Change: D203G

PolyPhen 2 Score 0.067 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000096701
Gene: ENSMUSG00000054582
AA Change: D203G

DomainStartEndE-ValueType
RRM 12 85 2.3e-23 SMART
RRM 100 171 1.84e-22 SMART
RRM 192 264 2.31e-28 SMART
RRM 295 366 7.07e-24 SMART
SCOP:d1g9la_ 425 478 1e-6 SMART
PolyA 535 598 8.33e-27 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired oocyte maturation and female infertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578I06Rik T C 14: 63,986,096 K77R probably benign Het
Acta1 C T 8: 123,892,571 E261K possibly damaging Het
Adamts19 A T 18: 59,007,372 I848L possibly damaging Het
Adck1 C A 12: 88,368,479 T45K probably damaging Het
Agl A G 3: 116,772,846 F291S Het
BC048671 T C 6: 90,302,867 V24A probably benign Het
Brsk2 C T 7: 141,984,474 A119V probably damaging Het
Cacnb1 A G 11: 98,003,293 Y468H probably benign Het
Cep89 A T 7: 35,427,716 K501* probably null Het
Ces2a T A 8: 104,739,033 F306I probably damaging Het
Col6a4 T A 9: 106,075,329 I457F possibly damaging Het
Cts7 A G 13: 61,356,909 probably null Het
Dnah12 C A 14: 26,711,065 T444K probably benign Het
Dusp5 T C 19: 53,540,975 S270P probably damaging Het
Eppk1 T TCAC 15: 76,107,952 probably null Het
Esam T A 9: 37,537,066 I267K probably benign Het
Fastkd1 A G 2: 69,712,145 V106A probably damaging Het
Fsip2 A G 2: 82,990,755 T5611A possibly damaging Het
Gcc2 A G 10: 58,272,367 D933G probably damaging Het
Gm16506 T A 14: 43,727,368 H39L Het
Gm5145 A T 17: 20,570,425 N22Y probably damaging Het
Gm6465 A T 5: 11,846,813 R50W probably damaging Het
Hivep1 C A 13: 42,155,929 D548E probably benign Het
Hnrnpl C A 7: 28,814,037 S178R possibly damaging Het
Hsp90b1 A G 10: 86,691,104 *803Q probably null Het
Kdm5a A G 6: 120,419,446 N1088S probably benign Het
Klk11 C T 7: 43,776,441 probably benign Het
Kmt5b T C 19: 3,815,531 I865T probably damaging Het
Map3k10 C A 7: 27,673,459 R189L probably benign Het
Nav3 A G 10: 109,767,569 S1040P probably damaging Het
Neb T C 2: 52,273,890 S2019G probably damaging Het
Nfrkb T C 9: 31,403,519 V545A possibly damaging Het
Nkd2 G T 13: 73,821,073 P425T probably damaging Het
Olfr196 T C 16: 59,167,555 Y196C possibly damaging Het
Ostm1 A G 10: 42,696,338 Y239C probably damaging Het
Pcdhb21 T A 18: 37,515,889 Y690* probably null Het
Pla2r1 C A 2: 60,422,683 V1355F possibly damaging Het
Pms1 C T 1: 53,206,826 S518N probably benign Het
Rab44 A T 17: 29,148,275 *726C probably null Het
Rin1 A T 19: 5,054,985 H691L possibly damaging Het
Slc30a9 T A 5: 67,315,715 Y47* probably null Het
Sp9 T A 2: 73,274,452 V450D possibly damaging Het
Sstr3 T C 15: 78,540,493 N18S probably damaging Het
Sugct T A 13: 16,857,919 Y416F probably benign Het
Tcf3 T C 10: 80,421,166 T75A probably benign Het
Tenm3 A G 8: 48,293,773 V999A probably damaging Het
Tfap2c T A 2: 172,557,192 L453* probably null Het
Trip12 A T 1: 84,766,041 M515K probably benign Het
Vstm2a G A 11: 16,257,801 probably benign Het
Other mutations in Pabpc1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00480:Pabpc1l APN 2 164042317 missense probably damaging 1.00
IGL00911:Pabpc1l APN 2 164042423 missense probably damaging 1.00
IGL02096:Pabpc1l APN 2 164044347 missense probably benign 0.00
IGL02198:Pabpc1l APN 2 164027616 missense probably damaging 0.97
IGL02534:Pabpc1l APN 2 164027490 missense probably damaging 1.00
IGL02684:Pabpc1l APN 2 164031277 missense probably benign
R0371:Pabpc1l UTSW 2 164035272 missense probably benign 0.08
R0799:Pabpc1l UTSW 2 164031214 missense probably benign
R1202:Pabpc1l UTSW 2 164037171 missense possibly damaging 0.74
R1203:Pabpc1l UTSW 2 164037171 missense possibly damaging 0.74
R1548:Pabpc1l UTSW 2 164037171 missense possibly damaging 0.74
R1549:Pabpc1l UTSW 2 164037171 missense possibly damaging 0.74
R1687:Pabpc1l UTSW 2 164044306 missense probably benign 0.00
R1928:Pabpc1l UTSW 2 164032254 missense possibly damaging 0.70
R2698:Pabpc1l UTSW 2 164044382 critical splice donor site probably null
R3925:Pabpc1l UTSW 2 164027676 splice site probably benign
R3944:Pabpc1l UTSW 2 164042327 missense probably damaging 1.00
R4052:Pabpc1l UTSW 2 164043613 missense probably benign 0.20
R4793:Pabpc1l UTSW 2 164027622 missense possibly damaging 0.94
R5001:Pabpc1l UTSW 2 164042518 missense probably benign 0.00
R5104:Pabpc1l UTSW 2 164043587 missense probably benign 0.00
R5456:Pabpc1l UTSW 2 164027660 missense probably damaging 1.00
R5569:Pabpc1l UTSW 2 164043554 missense probably benign 0.00
R5853:Pabpc1l UTSW 2 164049518 missense probably benign 0.00
R5857:Pabpc1l UTSW 2 164044255 splice site probably null
R7107:Pabpc1l UTSW 2 164042479 missense probably damaging 0.99
R7650:Pabpc1l UTSW 2 164049590 missense probably benign 0.28
R8330:Pabpc1l UTSW 2 164027648 missense probably damaging 1.00
T0722:Pabpc1l UTSW 2 164042420 missense possibly damaging 0.89
Z1088:Pabpc1l UTSW 2 164032324 splice site probably null
Predicted Primers PCR Primer
(F):5'- CTGAAGGATAGCAATTGGTCCAAG -3'
(R):5'- ACAGGTTTAGCAGGGAGTCG -3'

Sequencing Primer
(F):5'- TCCAAGTGACCTAGGGTTGC -3'
(R):5'- TTAGCAGGGAGTCGGGGGAG -3'
Posted On2020-09-02