Incidental Mutation 'R0070:Stra6'
ID64462
Institutional Source Beutler Lab
Gene Symbol Stra6
Ensembl Gene ENSMUSG00000032327
Gene Namestimulated by retinoic acid gene 6
Synonyms
MMRRC Submission 038361-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock #R0070 (G1)
Quality Score139
Status Validated
Chromosome9
Chromosomal Location58063788-58153996 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) C to T at 58152615 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000130232 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034880] [ENSMUST00000041477] [ENSMUST00000085677] [ENSMUST00000167479] [ENSMUST00000168864] [ENSMUST00000170397]
Predicted Effect probably benign
Transcript: ENSMUST00000034880
SMART Domains Protein: ENSMUSP00000034880
Gene: ENSMUSG00000032327

DomainStartEndE-ValueType
Pfam:RBP_receptor 40 659 1.6e-253 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000041477
SMART Domains Protein: ENSMUSP00000045142
Gene: ENSMUSG00000037206

DomainStartEndE-ValueType
low complexity region 3 16 N/A INTRINSIC
LRRNT 18 54 3.32e-1 SMART
LRR 50 72 1.49e1 SMART
LRR 73 96 5.26e0 SMART
LRR 97 120 1.86e1 SMART
LRR_TYP 121 144 5.81e-2 SMART
LRR_TYP 145 168 5.21e-4 SMART
LRRCT 180 230 2.42e-9 SMART
IGc2 248 334 9.78e-7 SMART
low complexity region 408 426 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000085677
SMART Domains Protein: ENSMUSP00000082820
Gene: ENSMUSG00000032327

DomainStartEndE-ValueType
Pfam:RBP_receptor 41 658 1.9e-248 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000167479
SMART Domains Protein: ENSMUSP00000128417
Gene: ENSMUSG00000032327

DomainStartEndE-ValueType
Pfam:RBP_receptor 40 659 1.6e-253 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168864
SMART Domains Protein: ENSMUSP00000126963
Gene: ENSMUSG00000037206

DomainStartEndE-ValueType
low complexity region 3 16 N/A INTRINSIC
LRRNT 18 54 3.32e-1 SMART
LRR 50 72 1.49e1 SMART
LRR 73 96 5.26e0 SMART
LRR 97 120 1.86e1 SMART
LRR_TYP 121 144 5.81e-2 SMART
LRR_TYP 145 168 5.21e-4 SMART
LRRCT 180 230 2.42e-9 SMART
IGc2 248 334 9.78e-7 SMART
low complexity region 408 426 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170397
SMART Domains Protein: ENSMUSP00000130232
Gene: ENSMUSG00000032327

DomainStartEndE-ValueType
Pfam:RBP_receptor 40 659 1.6e-253 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 96.1%
Validation Efficiency 97% (68/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a membrane protein involved in the metabolism of retinol. The encoded protein acts as a receptor for retinol/retinol binding protein complexes. This protein removes the retinol from the complex and transports it across the cell membrane. Defects in this gene are a cause of syndromic microphthalmia type 9 (MCOPS9). Several transcript variants encoding a few different isoforms have been found for this gene. [provided by RefSeq, Dec 2008]
PHENOTYPE: Male mice homozygous for a gene trap allele exhibit growth retardation. Mice homozygous for a knock-out allele exhibit persistent hyperplastic primary vitreous, shorter inner and outer segment and reduced rod and cone function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgre4 T C 17: 55,802,154 I387T probably damaging Het
Alpi A G 1: 87,101,159 probably benign Het
Ankfn1 A T 11: 89,392,302 L173Q probably damaging Het
Atp2a1 T C 7: 126,447,452 E892G probably benign Het
AU018091 T C 7: 3,158,898 probably null Het
Capn12 T C 7: 28,889,126 probably benign Het
Capn2 C A 1: 182,473,869 probably benign Het
Cd79b A G 11: 106,311,918 probably benign Het
Cdh7 C T 1: 110,098,372 A446V probably benign Het
Ciapin1 T C 8: 94,825,219 N246S possibly damaging Het
Cmip T A 8: 117,426,554 I270N probably damaging Het
Cyp2d40 A G 15: 82,760,774 V225A unknown Het
Dnah9 A G 11: 66,160,040 V142A probably benign Het
Fam126a T C 5: 23,964,999 S451G probably damaging Het
Flt3 A G 5: 147,372,726 probably benign Het
Gm10238 A G 15: 75,237,585 noncoding transcript Het
Gm4787 T A 12: 81,379,066 D106V probably damaging Het
Hipk2 G A 6: 38,818,984 R117* probably null Het
Ifna11 A G 4: 88,820,275 D106G possibly damaging Het
Igkv1-115 G A 6: 68,161,418 V2I probably benign Het
Itga6 T C 2: 71,826,716 probably benign Het
Kcnj6 C A 16: 94,941,197 K5N probably benign Het
Kcnt1 T C 2: 25,892,362 V191A probably benign Het
Lcorl G A 5: 45,733,701 R437C probably damaging Het
Man2a1 G A 17: 64,659,079 probably null Het
Map3k14 T A 11: 103,239,554 probably null Het
Mtch1 T A 17: 29,340,059 probably benign Het
Myo1c A G 11: 75,660,250 N217S probably benign Het
Olfr132 A G 17: 38,130,889 L101P probably damaging Het
Olfr1362 T C 13: 21,611,261 K236R possibly damaging Het
Orm3 A G 4: 63,356,646 T64A probably benign Het
Phf20l1 T G 15: 66,639,991 W940G probably damaging Het
Phldb1 C T 9: 44,707,904 R844H probably damaging Het
Piezo2 T C 18: 63,102,084 D814G probably damaging Het
Pkd2 T C 5: 104,466,990 C233R probably damaging Het
Prkd3 A G 17: 78,954,510 Y792H probably damaging Het
Pth1r A T 9: 110,727,550 probably null Het
Pxdn T C 12: 29,982,727 L146S probably damaging Het
Rnf32 A G 5: 29,225,127 T315A probably benign Het
Rpl5 T C 5: 107,901,900 Y12H probably benign Het
Serpinh1 A T 7: 99,349,314 S36R probably damaging Het
Setx A T 2: 29,161,525 T2030S probably benign Het
Sf3a3 G A 4: 124,714,955 V21I probably benign Het
Sin3b T A 8: 72,725,582 H105Q probably damaging Het
Slitrk1 T C 14: 108,913,317 probably benign Het
Slx4 A T 16: 3,988,016 D557E possibly damaging Het
Sprr3 C T 3: 92,457,302 M78I probably benign Het
Ssmem1 A G 6: 30,519,421 E35G possibly damaging Het
Stag1 C T 9: 100,956,408 P1238S probably null Het
Tmem127 T C 2: 127,257,059 V171A probably damaging Het
Tmem150a A G 6: 72,358,759 probably null Het
Top2a C G 11: 99,015,060 probably null Het
Ttn T C 2: 76,814,427 probably null Het
Tusc3 G A 8: 39,063,267 G129R possibly damaging Het
Uspl1 A G 5: 149,209,705 Y422C probably damaging Het
Vmn2r88 A T 14: 51,414,140 T312S probably benign Het
Wdr78 A T 4: 103,059,934 I571K probably damaging Het
Zc3hav1l A T 6: 38,295,190 S215T probably damaging Het
Zfp947 T A 17: 22,146,184 T170S probably benign Het
Other mutations in Stra6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01327:Stra6 APN 9 58152571 missense probably benign 0.01
IGL01885:Stra6 APN 9 58141148 missense probably damaging 1.00
IGL02219:Stra6 APN 9 58140469 missense probably benign 0.18
IGL02550:Stra6 APN 9 58150083 missense possibly damaging 0.95
IGL02745:Stra6 APN 9 58152038 missense probably damaging 1.00
IGL02999:Stra6 APN 9 58135113 missense probably benign 0.19
R0034:Stra6 UTSW 9 58151469 splice site probably null
R0070:Stra6 UTSW 9 58152615 splice site probably benign
R0281:Stra6 UTSW 9 58145489 missense probably benign 0.11
R0387:Stra6 UTSW 9 58153183 missense probably benign 0.13
R0879:Stra6 UTSW 9 58135204 critical splice donor site probably null
R1075:Stra6 UTSW 9 58151404 missense possibly damaging 0.79
R1605:Stra6 UTSW 9 58151883 missense probably benign
R1840:Stra6 UTSW 9 58140530 missense probably benign 0.00
R1896:Stra6 UTSW 9 58151883 missense probably benign
R2149:Stra6 UTSW 9 58152539 missense probably benign 0.01
R4016:Stra6 UTSW 9 58135190 missense probably damaging 0.99
R4127:Stra6 UTSW 9 58151218 missense probably damaging 1.00
R4243:Stra6 UTSW 9 58143026 missense probably benign 0.06
R4631:Stra6 UTSW 9 58140832 intron probably benign
R4671:Stra6 UTSW 9 58149234 missense probably benign 0.01
R4688:Stra6 UTSW 9 58135076 critical splice acceptor site probably null
R5091:Stra6 UTSW 9 58141146 missense probably damaging 1.00
R6179:Stra6 UTSW 9 58135169 missense probably damaging 1.00
R6486:Stra6 UTSW 9 58151422 frame shift probably null
R6593:Stra6 UTSW 9 58151979 missense probably benign 0.00
R7368:Stra6 UTSW 9 58151260 missense probably benign 0.03
R7395:Stra6 UTSW 9 58141097 missense probably damaging 1.00
R7503:Stra6 UTSW 9 58151245 missense possibly damaging 0.70
R7807:Stra6 UTSW 9 58150161 missense probably damaging 0.97
R8099:Stra6 UTSW 9 58152494 missense probably damaging 1.00
R8377:Stra6 UTSW 9 58149205 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACTTCCTGAGGATTGAGGCCAGC -3'
(R):5'- TGTAGCAACTGCATCCCTGAGAGAG -3'

Sequencing Primer
(F):5'- ATTGAGGCCAGCCAGTCAC -3'
(R):5'- GAGGAGTATCTAGGCCATTCCATC -3'
Posted On2013-08-06