Mutagenetix > Incidental Mutation

Incidental Mutation 'R0070:Stra6'

64462

Institutional Source

Beutler Lab

Gene Symbol

Stra6

Ensembl Gene

ENSMUSG00000032327

Gene Name

stimulated by retinoic acid gene 6

Synonyms

MMRRC Submission

038361-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.080) question?

Stock #

R0070 (G1)

Quality Score

139

Status

Validated

Chromosome

Chromosomal Location

58063788-58153996 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

C to T at 58152615 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000130232 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034880] [ENSMUST00000041477] [ENSMUST00000085677] [ENSMUST00000167479] [ENSMUST00000168864] [ENSMUST00000170397]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000034880

SMART Domains

Protein: ENSMUSP00000034880
Gene: ENSMUSG00000032327

Domain	Start	End	E-Value	Type
Pfam:RBP_receptor	40	659	1.6e-253	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000041477

SMART Domains

Protein: ENSMUSP00000045142
Gene: ENSMUSG00000037206

Domain	Start	End	E-Value	Type
low complexity region	3	16	N/A	INTRINSIC
LRRNT	18	54	3.32e-1	SMART
LRR	50	72	1.49e1	SMART
LRR	73	96	5.26e0	SMART
LRR	97	120	1.86e1	SMART
LRR_TYP	121	144	5.81e-2	SMART
LRR_TYP	145	168	5.21e-4	SMART
LRRCT	180	230	2.42e-9	SMART
IGc2	248	334	9.78e-7	SMART
low complexity region	408	426	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000085677

SMART Domains

Protein: ENSMUSP00000082820
Gene: ENSMUSG00000032327

Domain	Start	End	E-Value	Type
Pfam:RBP_receptor	41	658	1.9e-248	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000167479

SMART Domains

Protein: ENSMUSP00000128417
Gene: ENSMUSG00000032327

Domain	Start	End	E-Value	Type
Pfam:RBP_receptor	40	659	1.6e-253	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000168864

SMART Domains

Protein: ENSMUSP00000126963
Gene: ENSMUSG00000037206

Domain	Start	End	E-Value	Type
low complexity region	3	16	N/A	INTRINSIC
LRRNT	18	54	3.32e-1	SMART
LRR	50	72	1.49e1	SMART
LRR	73	96	5.26e0	SMART
LRR	97	120	1.86e1	SMART
LRR_TYP	121	144	5.81e-2	SMART
LRR_TYP	145	168	5.21e-4	SMART
LRRCT	180	230	2.42e-9	SMART
IGc2	248	334	9.78e-7	SMART
low complexity region	408	426	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000170397

SMART Domains

Protein: ENSMUSP00000130232
Gene: ENSMUSG00000032327

Domain	Start	End	E-Value	Type
Pfam:RBP_receptor	40	659	1.6e-253	PFAM

Coding Region Coverage

1x: 99.3%
3x: 98.9%
10x: 97.7%
20x: 96.1%

Validation Efficiency

97% (68/70)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a membrane protein involved in the metabolism of retinol. The encoded protein acts as a receptor for retinol/retinol binding protein complexes. This protein removes the retinol from the complex and transports it across the cell membrane. Defects in this gene are a cause of syndromic microphthalmia type 9 (MCOPS9). Several transcript variants encoding a few different isoforms have been found for this gene. [provided by RefSeq, Dec 2008]
PHENOTYPE: Male mice homozygous for a gene trap allele exhibit growth retardation. Mice homozygous for a knock-out allele exhibit persistent hyperplastic primary vitreous, shorter inner and outer segment and reduced rod and cone function. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgre4	T	C	17: 55,802,154	I387T	probably damaging	Het
Alpi	A	G	1: 87,101,159		probably benign	Het
Ankfn1	A	T	11: 89,392,302	L173Q	probably damaging	Het
Atp2a1	T	C	7: 126,447,452	E892G	probably benign	Het
AU018091	T	C	7: 3,158,898		probably null	Het
Capn12	T	C	7: 28,889,126		probably benign	Het
Capn2	C	A	1: 182,473,869		probably benign	Het
Cd79b	A	G	11: 106,311,918		probably benign	Het
Cdh7	C	T	1: 110,098,372	A446V	probably benign	Het
Ciapin1	T	C	8: 94,825,219	N246S	possibly damaging	Het
Cmip	T	A	8: 117,426,554	I270N	probably damaging	Het
Cyp2d40	A	G	15: 82,760,774	V225A	unknown	Het
Dnah9	A	G	11: 66,160,040	V142A	probably benign	Het
Fam126a	T	C	5: 23,964,999	S451G	probably damaging	Het
Flt3	A	G	5: 147,372,726		probably benign	Het
Gm10238	A	G	15: 75,237,585		noncoding transcript	Het
Gm4787	T	A	12: 81,379,066	D106V	probably damaging	Het
Hipk2	G	A	6: 38,818,984	R117*	probably null	Het
Ifna11	A	G	4: 88,820,275	D106G	possibly damaging	Het
Igkv1-115	G	A	6: 68,161,418	V2I	probably benign	Het
Itga6	T	C	2: 71,826,716		probably benign	Het
Kcnj6	C	A	16: 94,941,197	K5N	probably benign	Het
Kcnt1	T	C	2: 25,892,362	V191A	probably benign	Het
Lcorl	G	A	5: 45,733,701	R437C	probably damaging	Het
Man2a1	G	A	17: 64,659,079		probably null	Het
Map3k14	T	A	11: 103,239,554		probably null	Het
Mtch1	T	A	17: 29,340,059		probably benign	Het
Myo1c	A	G	11: 75,660,250	N217S	probably benign	Het
Olfr132	A	G	17: 38,130,889	L101P	probably damaging	Het
Olfr1362	T	C	13: 21,611,261	K236R	possibly damaging	Het
Orm3	A	G	4: 63,356,646	T64A	probably benign	Het
Phf20l1	T	G	15: 66,639,991	W940G	probably damaging	Het
Phldb1	C	T	9: 44,707,904	R844H	probably damaging	Het
Piezo2	T	C	18: 63,102,084	D814G	probably damaging	Het
Pkd2	T	C	5: 104,466,990	C233R	probably damaging	Het
Prkd3	A	G	17: 78,954,510	Y792H	probably damaging	Het
Pth1r	A	T	9: 110,727,550		probably null	Het
Pxdn	T	C	12: 29,982,727	L146S	probably damaging	Het
Rnf32	A	G	5: 29,225,127	T315A	probably benign	Het
Rpl5	T	C	5: 107,901,900	Y12H	probably benign	Het
Serpinh1	A	T	7: 99,349,314	S36R	probably damaging	Het
Setx	A	T	2: 29,161,525	T2030S	probably benign	Het
Sf3a3	G	A	4: 124,714,955	V21I	probably benign	Het
Sin3b	T	A	8: 72,725,582	H105Q	probably damaging	Het
Slitrk1	T	C	14: 108,913,317		probably benign	Het
Slx4	A	T	16: 3,988,016	D557E	possibly damaging	Het
Sprr3	C	T	3: 92,457,302	M78I	probably benign	Het
Ssmem1	A	G	6: 30,519,421	E35G	possibly damaging	Het
Stag1	C	T	9: 100,956,408	P1238S	probably null	Het
Tmem127	T	C	2: 127,257,059	V171A	probably damaging	Het
Tmem150a	A	G	6: 72,358,759		probably null	Het
Top2a	C	G	11: 99,015,060		probably null	Het
Ttn	T	C	2: 76,814,427		probably null	Het
Tusc3	G	A	8: 39,063,267	G129R	possibly damaging	Het
Uspl1	A	G	5: 149,209,705	Y422C	probably damaging	Het
Vmn2r88	A	T	14: 51,414,140	T312S	probably benign	Het
Wdr78	A	T	4: 103,059,934	I571K	probably damaging	Het
Zc3hav1l	A	T	6: 38,295,190	S215T	probably damaging	Het
Zfp947	T	A	17: 22,146,184	T170S	probably benign	Het

Other mutations in Stra6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01327:Stra6	APN	9	58152571	missense	probably benign	0.01
IGL01885:Stra6	APN	9	58141148	missense	probably damaging	1.00
IGL02219:Stra6	APN	9	58140469	missense	probably benign	0.18
IGL02550:Stra6	APN	9	58150083	missense	possibly damaging	0.95
IGL02745:Stra6	APN	9	58152038	missense	probably damaging	1.00
IGL02999:Stra6	APN	9	58135113	missense	probably benign	0.19
R0034:Stra6	UTSW	9	58151469	splice site	probably null
R0070:Stra6	UTSW	9	58152615	splice site	probably benign
R0281:Stra6	UTSW	9	58145489	missense	probably benign	0.11
R0387:Stra6	UTSW	9	58153183	missense	probably benign	0.13
R0879:Stra6	UTSW	9	58135204	critical splice donor site	probably null
R1075:Stra6	UTSW	9	58151404	missense	possibly damaging	0.79
R1605:Stra6	UTSW	9	58151883	missense	probably benign
R1840:Stra6	UTSW	9	58140530	missense	probably benign	0.00
R1896:Stra6	UTSW	9	58151883	missense	probably benign
R2149:Stra6	UTSW	9	58152539	missense	probably benign	0.01
R4016:Stra6	UTSW	9	58135190	missense	probably damaging	0.99
R4127:Stra6	UTSW	9	58151218	missense	probably damaging	1.00
R4243:Stra6	UTSW	9	58143026	missense	probably benign	0.06
R4631:Stra6	UTSW	9	58140832	intron	probably benign
R4671:Stra6	UTSW	9	58149234	missense	probably benign	0.01
R4688:Stra6	UTSW	9	58135076	critical splice acceptor site	probably null
R5091:Stra6	UTSW	9	58141146	missense	probably damaging	1.00
R6179:Stra6	UTSW	9	58135169	missense	probably damaging	1.00
R6486:Stra6	UTSW	9	58151422	frame shift	probably null
R6593:Stra6	UTSW	9	58151979	missense	probably benign	0.00
R7368:Stra6	UTSW	9	58151260	missense	probably benign	0.03
R7395:Stra6	UTSW	9	58141097	missense	probably damaging	1.00
R7503:Stra6	UTSW	9	58151245	missense	possibly damaging	0.70
R7807:Stra6	UTSW	9	58150161	missense	probably damaging	0.97
R8099:Stra6	UTSW	9	58152494	missense	probably damaging	1.00
R8377:Stra6	UTSW	9	58149205	missense	probably damaging	1.00
R8780:Stra6	UTSW	9	58134971	intron	probably benign
R8817:Stra6	UTSW	9	58151982	missense	possibly damaging	0.94
R9117:Stra6	UTSW	9	58152539	missense	probably benign	0.01
R9495:Stra6	UTSW	9	58151892	missense	probably benign	0.03
R9582:Stra6	UTSW	9	58147487	missense	probably damaging	0.97

Predicted Primers

PCR Primer
(F):5'- AACTTCCTGAGGATTGAGGCCAGC -3'
(R):5'- TGTAGCAACTGCATCCCTGAGAGAG -3'

Sequencing Primer
(F):5'- ATTGAGGCCAGCCAGTCAC -3'
(R):5'- GAGGAGTATCTAGGCCATTCCATC -3'

Posted On

2013-08-06