Incidental Mutation 'R8336:Dusp5'
ID 644648
Institutional Source Beutler Lab
Gene Symbol Dusp5
Ensembl Gene ENSMUSG00000034765
Gene Name dual specificity phosphatase 5
Synonyms LOC240672
MMRRC Submission 067729-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8336 (G1)
Quality Score 225.009
Status Not validated
Chromosome 19
Chromosomal Location 53517576-53530240 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 53529406 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 270 (S270P)
Ref Sequence ENSEMBL: ENSMUSP00000047900 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038287]
AlphaFold Q1HL35
Predicted Effect probably damaging
Transcript: ENSMUST00000038287
AA Change: S270P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000047900
Gene: ENSMUSG00000034765
AA Change: S270P

DomainStartEndE-ValueType
RHOD 9 138 1.88e-13 SMART
DSPc 178 316 4.48e-56 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mitogen-activated protein (MAP) kinase superfamily (MAPK/ERK, SAPK/JNK, p38), which are associated with cellular proliferation and differentiation. Different members of the family of dual specificity phosphatases show distinct substrate specificities for various MAP kinases, different tissue distribution and subcellular localization, and different modes of inducibility of their expression by extracellular stimuli. This gene product inactivates ERK1, is expressed in a variety of tissues with the highest levels in pancreas and brain, and is localized in the nucleus. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased proliferation and apoptosis and altered metabolic profiles in T cells. Mice homozygous for other null alleles exhibit altered eosinophilic response to parasicitc infection and increased susceptibility to induced tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578I06Rik T C 14: 64,223,545 (GRCm39) K77R probably benign Het
Acta1 C T 8: 124,619,310 (GRCm39) E261K possibly damaging Het
Adamts19 A T 18: 59,140,444 (GRCm39) I848L possibly damaging Het
Adck1 C A 12: 88,335,249 (GRCm39) T45K probably damaging Het
Agl A G 3: 116,566,495 (GRCm39) F291S Het
BC048671 T C 6: 90,279,849 (GRCm39) V24A probably benign Het
Brsk2 C T 7: 141,538,211 (GRCm39) A119V probably damaging Het
Cacnb1 A G 11: 97,894,119 (GRCm39) Y468H probably benign Het
Cep89 A T 7: 35,127,141 (GRCm39) K501* probably null Het
Ces2a T A 8: 105,465,665 (GRCm39) F306I probably damaging Het
Col6a4 T A 9: 105,952,528 (GRCm39) I457F possibly damaging Het
Cts7 A G 13: 61,504,723 (GRCm39) probably null Het
Dnah12 C A 14: 26,432,220 (GRCm39) T444K probably benign Het
Eppk1 T TCAC 15: 75,992,152 (GRCm39) probably null Het
Esam T A 9: 37,448,362 (GRCm39) I267K probably benign Het
Fastkd1 A G 2: 69,542,489 (GRCm39) V106A probably damaging Het
Fsip2 A G 2: 82,821,099 (GRCm39) T5611A possibly damaging Het
Gcc2 A G 10: 58,108,189 (GRCm39) D933G probably damaging Het
Gm16506 T A 14: 43,964,825 (GRCm39) H39L Het
Gm5145 A T 17: 20,790,687 (GRCm39) N22Y probably damaging Het
Gm6465 A T 5: 11,896,780 (GRCm39) R50W probably damaging Het
Hivep1 C A 13: 42,309,405 (GRCm39) D548E probably benign Het
Hnrnpl C A 7: 28,513,462 (GRCm39) S178R possibly damaging Het
Hsp90b1 A G 10: 86,526,968 (GRCm39) *803Q probably null Het
Kdm5a A G 6: 120,396,407 (GRCm39) N1088S probably benign Het
Klk1b11 C T 7: 43,425,865 (GRCm39) probably benign Het
Kmt5b T C 19: 3,865,531 (GRCm39) I865T probably damaging Het
Map3k10 C A 7: 27,372,884 (GRCm39) R189L probably benign Het
Nav3 A G 10: 109,603,430 (GRCm39) S1040P probably damaging Het
Neb T C 2: 52,163,902 (GRCm39) S2019G probably damaging Het
Nfrkb T C 9: 31,314,815 (GRCm39) V545A possibly damaging Het
Nkd2 G T 13: 73,969,192 (GRCm39) P425T probably damaging Het
Or5h26 T C 16: 58,987,918 (GRCm39) Y196C possibly damaging Het
Ostm1 A G 10: 42,572,334 (GRCm39) Y239C probably damaging Het
Pabpc1l A G 2: 163,874,204 (GRCm39) D203G probably benign Het
Pcdhb21 T A 18: 37,648,942 (GRCm39) Y690* probably null Het
Pla2r1 C A 2: 60,253,027 (GRCm39) V1355F possibly damaging Het
Pms1 C T 1: 53,245,985 (GRCm39) S518N probably benign Het
Rab44 A T 17: 29,367,249 (GRCm39) *726C probably null Het
Rin1 A T 19: 5,105,013 (GRCm39) H691L possibly damaging Het
Slc30a9 T A 5: 67,473,058 (GRCm39) Y47* probably null Het
Sp9 T A 2: 73,104,796 (GRCm39) V450D possibly damaging Het
Sstr3 T C 15: 78,424,693 (GRCm39) N18S probably damaging Het
Sugct T A 13: 17,032,504 (GRCm39) Y416F probably benign Het
Tcf3 T C 10: 80,257,000 (GRCm39) T75A probably benign Het
Tenm3 A G 8: 48,746,808 (GRCm39) V999A probably damaging Het
Tfap2c T A 2: 172,399,112 (GRCm39) L453* probably null Het
Trip12 A T 1: 84,743,762 (GRCm39) M515K probably benign Het
Vstm2a G A 11: 16,207,801 (GRCm39) probably benign Het
Other mutations in Dusp5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01949:Dusp5 APN 19 53,525,904 (GRCm39) missense probably damaging 1.00
IGL02017:Dusp5 APN 19 53,525,937 (GRCm39) missense probably damaging 1.00
R4523:Dusp5 UTSW 19 53,526,032 (GRCm39) missense probably damaging 1.00
R5350:Dusp5 UTSW 19 53,529,665 (GRCm39) missense probably damaging 1.00
R7941:Dusp5 UTSW 19 53,525,964 (GRCm39) missense probably benign
R8021:Dusp5 UTSW 19 53,517,929 (GRCm39) missense probably benign 0.13
R8142:Dusp5 UTSW 19 53,525,912 (GRCm39) missense probably damaging 1.00
R8155:Dusp5 UTSW 19 53,529,537 (GRCm39) nonsense probably null
R8353:Dusp5 UTSW 19 53,518,113 (GRCm39) missense possibly damaging 0.48
R8881:Dusp5 UTSW 19 53,529,745 (GRCm39) missense probably benign 0.05
R9640:Dusp5 UTSW 19 53,526,051 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTTAAGGACCTTACACTGGC -3'
(R):5'- TATAAACGTGGAGCTGGCTG -3'

Sequencing Primer
(F):5'- TTACACTGGCCCAGGGAAG -3'
(R):5'- TGGCTGCCTCCCCTTGG -3'
Posted On 2020-09-02