Mutagenetix > Incidental Mutation

Incidental Mutation 'R8337:Gm14085'

644656

Institutional Source

Beutler Lab

Gene Symbol

Gm14085

Ensembl Gene

ENSMUSG00000079071

Gene Name

predicted gene 14085

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.086) question?

Stock #

R8337 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

122484941-122528040 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 122525136 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Isoleucine at position 603 (T603I)

Ref Sequence

ENSEMBL: ENSMUSP00000106150 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000110521]

AlphaFold

A2AWR5

Predicted Effect

probably benign
Transcript: ENSMUST00000110521
AA Change: T603I

PolyPhen 2 Score 0.062 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000106150
Gene: ENSMUSG00000079071
AA Change: T603I

Domain	Start	End	E-Value	Type
transmembrane domain	76	98	N/A	INTRINSIC
transmembrane domain	103	125	N/A	INTRINSIC
transmembrane domain	149	166	N/A	INTRINSIC
Pfam:Nucleos_tra2_N	180	253	2.3e-28	PFAM
Pfam:Gate	260	360	1.7e-10	PFAM
Pfam:Nucleos_tra2_C	363	587	4.6e-70	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.2%

Validation Efficiency

100% (55/55)

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310034C09Rik	T	C	16: 88,759,263	Y122H	probably damaging	Het
Abhd14b	T	A	9: 106,450,041	H7Q	probably benign	Het
Acod1	C	T	14: 103,049,344	R28W	possibly damaging	Het
Agap2	A	G	10: 127,088,325	T803A	unknown	Het
Angptl7	T	C	4: 148,497,284	E215G	probably damaging	Het
Ankrd34c	T	A	9: 89,729,898	D130V	probably damaging	Het
BC028528	A	G	3: 95,884,986	V144A	probably benign	Het
Cab39l	T	C	14: 59,539,191	F274L	probably damaging	Het
Cdsn	T	C	17: 35,555,518	S315P	possibly damaging	Het
Celsr3	CGGGG	CGGGGG	9: 108,841,272		probably null	Het
Cep97	A	T	16: 55,915,031	L540*	probably null	Het
Chrna2	G	T	14: 66,149,568	E388*	probably null	Het
Ckap4	A	G	10: 84,528,596	V201A	probably damaging	Het
Clec4b1	A	G	6: 123,065,963	K47R	probably benign	Het
Clvs2	A	T	10: 33,528,488	I244N	possibly damaging	Het
Cmtr1	G	A	17: 29,674,177	E57K	probably benign	Het
Cxxc1	T	A	18: 74,220,839	D565E	possibly damaging	Het
Dpcr1	T	C	17: 35,637,594	H371R	possibly damaging	Het
Dtx3l	T	A	16: 35,933,703	M178L	probably benign	Het
Eml2	A	G	7: 19,196,236	D294G	possibly damaging	Het
Flt3	A	G	5: 147,332,888		probably null	Het
Frs3	T	A	17: 47,703,852	L490Q	probably damaging	Het
Gm35339	T	C	15: 76,361,484	V1307A		Het
Gm6882	G	A	7: 21,427,634	T103I	possibly damaging	Het
Gsdmd	C	T	15: 75,864,421	T133I	probably benign	Het
Hhipl2	C	A	1: 183,428,632	C331*	probably null	Het
Ifnar1	C	A	16: 91,505,336	D566E	possibly damaging	Het
Ighv1-34	A	T	12: 114,851,319	N74K	probably benign	Het
Itk	T	C	11: 46,342,395		probably null	Het
Kdm7a	T	C	6: 39,145,527	D801G	probably benign	Het
March1	T	C	8: 66,418,989	L139P	probably damaging	Het
Metap1d	T	C	2: 71,515,638	V181A	probably damaging	Het
Mfsd8	G	A	3: 40,835,193	R140C	probably damaging	Het
Mrps25	T	C	6: 92,175,764	T92A	probably benign	Het
Ntng2	C	A	2: 29,248,038	M1I	probably null	Het
Olfr635	A	C	7: 103,979,374	M61L	probably damaging	Het
Olfr64	C	T	7: 103,893,049	G229R	probably benign	Het
Olfr983	T	C	9: 40,092,399	K189R	probably benign	Het
Pla2g12a	A	G	3: 129,878,816	D33G	probably damaging	Het
Prlhr	A	G	19: 60,467,846	V94A	possibly damaging	Het
Ralgapb	T	A	2: 158,450,272	S793T	probably benign	Het
Rapgef6	T	A	11: 54,631,301	L455*	probably null	Het
Sbf2	T	C	7: 110,441,462	H386R	probably benign	Het
Sec23ip	C	A	7: 128,764,025	N539K	probably damaging	Het
Shisa4	A	G	1: 135,373,169	L121P	probably damaging	Het
Stard9	T	A	2: 120,679,825	F296I	probably damaging	Het
Strn3	T	C	12: 51,661,172	K147E	probably damaging	Het
Taf5l	T	C	8: 123,998,102	N326S	probably benign	Het
Tfb2m	T	A	1: 179,542,349	I170L	probably benign	Het
Tfec	T	C	6: 16,845,423	N79S	possibly damaging	Het
Tnn	C	T	1: 160,118,483	G922R	probably damaging	Het
Tox3	T	C	8: 90,347,879	Y24C	probably damaging	Het
Vmn2r6	A	T	3: 64,556,105	L436*	probably null	Het
Vmn2r80	A	G	10: 79,148,873	I20V	probably benign	Het

Other mutations in Gm14085

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00964:Gm14085	APN	2	122517046	missense	probably damaging	0.98
IGL01160:Gm14085	APN	2	122524796	critical splice acceptor site	probably null
IGL01838:Gm14085	APN	2	122517983	missense	possibly damaging	0.65
IGL01895:Gm14085	APN	2	122525091	missense	possibly damaging	0.75
IGL02999:Gm14085	APN	2	122514514	splice site	probably benign
Wilted	UTSW	2	122523482	missense	probably damaging	1.00
K2124:Gm14085	UTSW	2	122525153	missense	probably benign	0.00
R0084:Gm14085	UTSW	2	122522833	missense	possibly damaging	0.95
R0092:Gm14085	UTSW	2	122517597	splice site	probably benign
R0127:Gm14085	UTSW	2	122517069	critical splice donor site	probably null
R0200:Gm14085	UTSW	2	122527447	makesense	probably null
R0276:Gm14085	UTSW	2	122521928	missense	probably damaging	1.00
R0309:Gm14085	UTSW	2	122517553	missense	probably benign	0.04
R0403:Gm14085	UTSW	2	122521854	missense	probably damaging	1.00
R0600:Gm14085	UTSW	2	122514398	missense	probably damaging	0.97
R0612:Gm14085	UTSW	2	122521698	missense	probably damaging	1.00
R1676:Gm14085	UTSW	2	122521859	missense	probably damaging	0.99
R1801:Gm14085	UTSW	2	122521652	missense	possibly damaging	0.57
R1986:Gm14085	UTSW	2	122527429	missense	probably benign	0.00
R2050:Gm14085	UTSW	2	122522868	missense	probably benign	0.21
R3078:Gm14085	UTSW	2	122514414	missense	possibly damaging	0.63
R4075:Gm14085	UTSW	2	122514411	missense	probably benign	0.00
R4096:Gm14085	UTSW	2	122522728	missense	probably damaging	1.00
R4744:Gm14085	UTSW	2	122522805	nonsense	probably null
R4796:Gm14085	UTSW	2	122514459	missense	probably damaging	0.99
R5033:Gm14085	UTSW	2	122522914	critical splice donor site	probably null
R5069:Gm14085	UTSW	2	122494373	missense	possibly damaging	0.93
R5288:Gm14085	UTSW	2	122522778	missense	probably benign	0.01
R5385:Gm14085	UTSW	2	122522778	missense	probably benign	0.01
R5386:Gm14085	UTSW	2	122522778	missense	probably benign	0.01
R5442:Gm14085	UTSW	2	122486869	missense	probably benign
R5795:Gm14085	UTSW	2	122517994	missense	possibly damaging	0.79
R6258:Gm14085	UTSW	2	122523482	missense	probably damaging	1.00
R6260:Gm14085	UTSW	2	122523482	missense	probably damaging	1.00
R6383:Gm14085	UTSW	2	122524807	missense	probably benign	0.00
R7226:Gm14085	UTSW	2	122522532	missense	probably benign	0.00
R7574:Gm14085	UTSW	2	122522844	missense	not run
R7633:Gm14085	UTSW	2	122486680	missense	probably null	0.05
R7705:Gm14085	UTSW	2	122521629	critical splice acceptor site	probably null
R7726:Gm14085	UTSW	2	122486733	missense	probably damaging	0.99
R7998:Gm14085	UTSW	2	122494358	missense	probably damaging	0.97
R8269:Gm14085	UTSW	2	122521688	missense	probably damaging	1.00
R8546:Gm14085	UTSW	2	122522754	missense	probably benign	0.14
R8817:Gm14085	UTSW	2	122518507	missense	possibly damaging	0.95
R8931:Gm14085	UTSW	2	122518502	missense
R9070:Gm14085	UTSW	2	122521673	missense	probably damaging	1.00
R9542:Gm14085	UTSW	2	122494341	missense	probably benign	0.26
R9702:Gm14085	UTSW	2	122523531	missense	probably damaging	1.00
R9782:Gm14085	UTSW	2	122521857	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGGCAGAGACTACAGGATCTC -3'
(R):5'- CACAAGCATCCATGTAGTGTCTC -3'

Sequencing Primer
(F):5'- GCAGAGACTACAGGATCTCTCTCAG -3'
(R):5'- TGTCTCATACACTCCACACAG -3'

Posted On

2020-09-02