Incidental Mutation 'R8337:Gm14085'
ID644656
Institutional Source Beutler Lab
Gene Symbol Gm14085
Ensembl Gene ENSMUSG00000079071
Gene Namepredicted gene 14085
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R8337 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location122484941-122528040 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 122525136 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 603 (T603I)
Ref Sequence ENSEMBL: ENSMUSP00000106150 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110521]
Predicted Effect probably benign
Transcript: ENSMUST00000110521
AA Change: T603I

PolyPhen 2 Score 0.062 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000106150
Gene: ENSMUSG00000079071
AA Change: T603I

DomainStartEndE-ValueType
transmembrane domain 76 98 N/A INTRINSIC
transmembrane domain 103 125 N/A INTRINSIC
transmembrane domain 149 166 N/A INTRINSIC
Pfam:Nucleos_tra2_N 180 253 2.3e-28 PFAM
Pfam:Gate 260 360 1.7e-10 PFAM
Pfam:Nucleos_tra2_C 363 587 4.6e-70 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency 100% (55/55)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310034C09Rik T C 16: 88,759,263 Y122H probably damaging Het
Abhd14b T A 9: 106,450,041 H7Q probably benign Het
Acod1 C T 14: 103,049,344 R28W possibly damaging Het
Agap2 A G 10: 127,088,325 T803A unknown Het
Angptl7 T C 4: 148,497,284 E215G probably damaging Het
Ankrd34c T A 9: 89,729,898 D130V probably damaging Het
BC028528 A G 3: 95,884,986 V144A probably benign Het
Cab39l T C 14: 59,539,191 F274L probably damaging Het
Cdsn T C 17: 35,555,518 S315P possibly damaging Het
Celsr3 CGGGG CGGGGG 9: 108,841,272 probably null Het
Cep97 A T 16: 55,915,031 L540* probably null Het
Chrna2 G T 14: 66,149,568 E388* probably null Het
Ckap4 A G 10: 84,528,596 V201A probably damaging Het
Clec4b1 A G 6: 123,065,963 K47R probably benign Het
Clvs2 A T 10: 33,528,488 I244N possibly damaging Het
Cmtr1 G A 17: 29,674,177 E57K probably benign Het
Cxxc1 T A 18: 74,220,839 D565E possibly damaging Het
Dpcr1 T C 17: 35,637,594 H371R possibly damaging Het
Dtx3l T A 16: 35,933,703 M178L probably benign Het
Eml2 A G 7: 19,196,236 D294G possibly damaging Het
Flt3 A G 5: 147,332,888 probably null Het
Frs3 T A 17: 47,703,852 L490Q probably damaging Het
Gm35339 T C 15: 76,361,484 V1307A Het
Gm6882 G A 7: 21,427,634 T103I possibly damaging Het
Gsdmd C T 15: 75,864,421 T133I probably benign Het
Hhipl2 C A 1: 183,428,632 C331* probably null Het
Ifnar1 C A 16: 91,505,336 D566E possibly damaging Het
Ighv1-34 A T 12: 114,851,319 N74K probably benign Het
Itk T C 11: 46,342,395 probably null Het
Kdm7a T C 6: 39,145,527 D801G probably benign Het
March1 T C 8: 66,418,989 L139P probably damaging Het
Metap1d T C 2: 71,515,638 V181A probably damaging Het
Mfsd8 G A 3: 40,835,193 R140C probably damaging Het
Mrps25 T C 6: 92,175,764 T92A probably benign Het
Ntng2 C A 2: 29,248,038 M1I probably null Het
Olfr635 A C 7: 103,979,374 M61L probably damaging Het
Olfr64 C T 7: 103,893,049 G229R probably benign Het
Olfr983 T C 9: 40,092,399 K189R probably benign Het
Pla2g12a A G 3: 129,878,816 D33G probably damaging Het
Prlhr A G 19: 60,467,846 V94A possibly damaging Het
Ralgapb T A 2: 158,450,272 S793T probably benign Het
Rapgef6 T A 11: 54,631,301 L455* probably null Het
Sbf2 T C 7: 110,441,462 H386R probably benign Het
Sec23ip C A 7: 128,764,025 N539K probably damaging Het
Shisa4 A G 1: 135,373,169 L121P probably damaging Het
Stard9 T A 2: 120,679,825 F296I probably damaging Het
Strn3 T C 12: 51,661,172 K147E probably damaging Het
Taf5l T C 8: 123,998,102 N326S probably benign Het
Tfb2m T A 1: 179,542,349 I170L probably benign Het
Tfec T C 6: 16,845,423 N79S possibly damaging Het
Tnn C T 1: 160,118,483 G922R probably damaging Het
Tox3 T C 8: 90,347,879 Y24C probably damaging Het
Vmn2r6 A T 3: 64,556,105 L436* probably null Het
Vmn2r80 A G 10: 79,148,873 I20V probably benign Het
Other mutations in Gm14085
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00964:Gm14085 APN 2 122517046 missense probably damaging 0.98
IGL01160:Gm14085 APN 2 122524796 critical splice acceptor site probably null
IGL01838:Gm14085 APN 2 122517983 missense possibly damaging 0.65
IGL01895:Gm14085 APN 2 122525091 missense possibly damaging 0.75
IGL02999:Gm14085 APN 2 122514514 splice site probably benign
Wilted UTSW 2 122523482 missense probably damaging 1.00
K2124:Gm14085 UTSW 2 122525153 missense probably benign 0.00
R0084:Gm14085 UTSW 2 122522833 missense possibly damaging 0.95
R0092:Gm14085 UTSW 2 122517597 splice site probably benign
R0127:Gm14085 UTSW 2 122517069 critical splice donor site probably null
R0200:Gm14085 UTSW 2 122527447 makesense probably null
R0276:Gm14085 UTSW 2 122521928 missense probably damaging 1.00
R0309:Gm14085 UTSW 2 122517553 missense probably benign 0.04
R0403:Gm14085 UTSW 2 122521854 missense probably damaging 1.00
R0600:Gm14085 UTSW 2 122514398 missense probably damaging 0.97
R0612:Gm14085 UTSW 2 122521698 missense probably damaging 1.00
R1676:Gm14085 UTSW 2 122521859 missense probably damaging 0.99
R1801:Gm14085 UTSW 2 122521652 missense possibly damaging 0.57
R1986:Gm14085 UTSW 2 122527429 missense probably benign 0.00
R2050:Gm14085 UTSW 2 122522868 missense probably benign 0.21
R3078:Gm14085 UTSW 2 122514414 missense possibly damaging 0.63
R4075:Gm14085 UTSW 2 122514411 missense probably benign 0.00
R4096:Gm14085 UTSW 2 122522728 missense probably damaging 1.00
R4744:Gm14085 UTSW 2 122522805 nonsense probably null
R4796:Gm14085 UTSW 2 122514459 missense probably damaging 0.99
R5033:Gm14085 UTSW 2 122522914 critical splice donor site probably null
R5069:Gm14085 UTSW 2 122494373 missense possibly damaging 0.93
R5288:Gm14085 UTSW 2 122522778 missense probably benign 0.01
R5385:Gm14085 UTSW 2 122522778 missense probably benign 0.01
R5386:Gm14085 UTSW 2 122522778 missense probably benign 0.01
R5442:Gm14085 UTSW 2 122486869 missense probably benign
R5795:Gm14085 UTSW 2 122517994 missense possibly damaging 0.79
R6258:Gm14085 UTSW 2 122523482 missense probably damaging 1.00
R6260:Gm14085 UTSW 2 122523482 missense probably damaging 1.00
R6383:Gm14085 UTSW 2 122524807 missense probably benign 0.00
R7226:Gm14085 UTSW 2 122522532 missense probably benign 0.00
R7574:Gm14085 UTSW 2 122522844 missense not run
R7633:Gm14085 UTSW 2 122486680 missense probably null 0.05
R7705:Gm14085 UTSW 2 122521629 critical splice acceptor site probably null
R7726:Gm14085 UTSW 2 122486733 missense probably damaging 0.99
R7998:Gm14085 UTSW 2 122494358 missense probably damaging 0.97
R8269:Gm14085 UTSW 2 122521688 missense probably damaging 1.00
R8546:Gm14085 UTSW 2 122522754 missense probably benign 0.14
R8817:Gm14085 UTSW 2 122518507 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TGGCAGAGACTACAGGATCTC -3'
(R):5'- CACAAGCATCCATGTAGTGTCTC -3'

Sequencing Primer
(F):5'- GCAGAGACTACAGGATCTCTCTCAG -3'
(R):5'- TGTCTCATACACTCCACACAG -3'
Posted On2020-09-02