Incidental Mutation 'R8337:Vmn2r6'
ID644660
Institutional Source Beutler Lab
Gene Symbol Vmn2r6
Ensembl Gene ENSMUSG00000090581
Gene Namevomeronasal 2, receptor 6
SynonymsEG620718, EG667069
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.139) question?
Stock #R8337 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location64537561-64565298 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 64556105 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 436 (L436*)
Ref Sequence ENSEMBL: ENSMUSP00000135148 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165012] [ENSMUST00000176481]
Predicted Effect probably null
Transcript: ENSMUST00000165012
AA Change: L347*
SMART Domains Protein: ENSMUSP00000131831
Gene: ENSMUSG00000090581
AA Change: L347*

DomainStartEndE-ValueType
Pfam:ANF_receptor 1 416 1.4e-72 PFAM
Pfam:Peripla_BP_6 58 244 1.2e-10 PFAM
Pfam:NCD3G 458 511 1.8e-17 PFAM
Pfam:7tm_3 542 779 3.9e-76 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000176481
AA Change: L436*
SMART Domains Protein: ENSMUSP00000135148
Gene: ENSMUSG00000090581
AA Change: L436*

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ANF_receptor 88 505 9.8e-77 PFAM
Pfam:Peripla_BP_6 142 331 3.4e-10 PFAM
Pfam:NCD3G 547 600 5.4e-17 PFAM
Pfam:7tm_3 633 867 3.9e-47 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency 100% (55/55)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310034C09Rik T C 16: 88,759,263 Y122H probably damaging Het
Abhd14b T A 9: 106,450,041 H7Q probably benign Het
Acod1 C T 14: 103,049,344 R28W possibly damaging Het
Agap2 A G 10: 127,088,325 T803A unknown Het
Angptl7 T C 4: 148,497,284 E215G probably damaging Het
Ankrd34c T A 9: 89,729,898 D130V probably damaging Het
BC028528 A G 3: 95,884,986 V144A probably benign Het
Cab39l T C 14: 59,539,191 F274L probably damaging Het
Cdsn T C 17: 35,555,518 S315P possibly damaging Het
Celsr3 CGGGG CGGGGG 9: 108,841,272 probably null Het
Cep97 A T 16: 55,915,031 L540* probably null Het
Chrna2 G T 14: 66,149,568 E388* probably null Het
Ckap4 A G 10: 84,528,596 V201A probably damaging Het
Clec4b1 A G 6: 123,065,963 K47R probably benign Het
Clvs2 A T 10: 33,528,488 I244N possibly damaging Het
Cmtr1 G A 17: 29,674,177 E57K probably benign Het
Cxxc1 T A 18: 74,220,839 D565E possibly damaging Het
Dpcr1 T C 17: 35,637,594 H371R possibly damaging Het
Dtx3l T A 16: 35,933,703 M178L probably benign Het
Eml2 A G 7: 19,196,236 D294G possibly damaging Het
Flt3 A G 5: 147,332,888 probably null Het
Frs3 T A 17: 47,703,852 L490Q probably damaging Het
Gm14085 C T 2: 122,525,136 T603I probably benign Het
Gm35339 T C 15: 76,361,484 V1307A Het
Gm6882 G A 7: 21,427,634 T103I possibly damaging Het
Gsdmd C T 15: 75,864,421 T133I probably benign Het
Hhipl2 C A 1: 183,428,632 C331* probably null Het
Ifnar1 C A 16: 91,505,336 D566E possibly damaging Het
Ighv1-34 A T 12: 114,851,319 N74K probably benign Het
Itk T C 11: 46,342,395 probably null Het
Kdm7a T C 6: 39,145,527 D801G probably benign Het
March1 T C 8: 66,418,989 L139P probably damaging Het
Metap1d T C 2: 71,515,638 V181A probably damaging Het
Mfsd8 G A 3: 40,835,193 R140C probably damaging Het
Mrps25 T C 6: 92,175,764 T92A probably benign Het
Ntng2 C A 2: 29,248,038 M1I probably null Het
Olfr635 A C 7: 103,979,374 M61L probably damaging Het
Olfr64 C T 7: 103,893,049 G229R probably benign Het
Olfr983 T C 9: 40,092,399 K189R probably benign Het
Pla2g12a A G 3: 129,878,816 D33G probably damaging Het
Prlhr A G 19: 60,467,846 V94A possibly damaging Het
Ralgapb T A 2: 158,450,272 S793T probably benign Het
Rapgef6 T A 11: 54,631,301 L455* probably null Het
Sbf2 T C 7: 110,441,462 H386R probably benign Het
Sec23ip C A 7: 128,764,025 N539K probably damaging Het
Shisa4 A G 1: 135,373,169 L121P probably damaging Het
Stard9 T A 2: 120,679,825 F296I probably damaging Het
Strn3 T C 12: 51,661,172 K147E probably damaging Het
Taf5l T C 8: 123,998,102 N326S probably benign Het
Tfb2m T A 1: 179,542,349 I170L probably benign Het
Tfec T C 6: 16,845,423 N79S possibly damaging Het
Tnn C T 1: 160,118,483 G922R probably damaging Het
Tox3 T C 8: 90,347,879 Y24C probably damaging Het
Vmn2r80 A G 10: 79,148,873 I20V probably benign Het
Other mutations in Vmn2r6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01547:Vmn2r6 APN 3 64538104 missense probably damaging 1.00
IGL01968:Vmn2r6 APN 3 64556345 missense possibly damaging 0.94
IGL02009:Vmn2r6 APN 3 64537902 missense possibly damaging 0.61
IGL02039:Vmn2r6 APN 3 64556189 missense probably damaging 1.00
IGL02652:Vmn2r6 APN 3 64556328 missense probably benign 0.24
IGL02737:Vmn2r6 APN 3 64556490 missense possibly damaging 0.55
IGL02808:Vmn2r6 APN 3 64556496 missense probably damaging 1.00
IGL03066:Vmn2r6 APN 3 64565153 missense probably damaging 0.99
IGL03331:Vmn2r6 APN 3 64538007 missense probably damaging 1.00
BB010:Vmn2r6 UTSW 3 64559803 missense probably benign 0.02
BB020:Vmn2r6 UTSW 3 64559803 missense probably benign 0.02
R0010:Vmn2r6 UTSW 3 64559545 nonsense probably null
R0206:Vmn2r6 UTSW 3 64539912 missense probably benign
R0206:Vmn2r6 UTSW 3 64539912 missense probably benign
R0208:Vmn2r6 UTSW 3 64539912 missense probably benign
R0427:Vmn2r6 UTSW 3 64559587 missense probably damaging 1.00
R0466:Vmn2r6 UTSW 3 64556302 missense probably damaging 1.00
R1018:Vmn2r6 UTSW 3 64556840 missense probably benign 0.00
R1104:Vmn2r6 UTSW 3 64538066 missense possibly damaging 0.93
R1186:Vmn2r6 UTSW 3 64565067 missense probably benign 0.01
R1245:Vmn2r6 UTSW 3 64556790 missense possibly damaging 0.53
R1295:Vmn2r6 UTSW 3 64538273 missense probably damaging 1.00
R1473:Vmn2r6 UTSW 3 64538158 nonsense probably null
R1498:Vmn2r6 UTSW 3 64556469 missense probably damaging 1.00
R1925:Vmn2r6 UTSW 3 64556277 missense possibly damaging 0.87
R2044:Vmn2r6 UTSW 3 64537841 missense probably damaging 0.96
R2069:Vmn2r6 UTSW 3 64556098 missense possibly damaging 0.89
R2253:Vmn2r6 UTSW 3 64559718 missense probably damaging 1.00
R2261:Vmn2r6 UTSW 3 64556669 missense probably benign 0.24
R2262:Vmn2r6 UTSW 3 64556669 missense probably benign 0.24
R2350:Vmn2r6 UTSW 3 64556352 missense probably benign 0.01
R2680:Vmn2r6 UTSW 3 64538286 missense possibly damaging 0.91
R2846:Vmn2r6 UTSW 3 64556790 missense possibly damaging 0.53
R2860:Vmn2r6 UTSW 3 64547339 missense probably benign 0.00
R2861:Vmn2r6 UTSW 3 64547339 missense probably benign 0.00
R3766:Vmn2r6 UTSW 3 64556508 missense probably benign 0.19
R3870:Vmn2r6 UTSW 3 64556621 missense probably damaging 0.96
R4018:Vmn2r6 UTSW 3 64556472 missense probably benign 0.05
R4024:Vmn2r6 UTSW 3 64538250 missense possibly damaging 0.73
R4026:Vmn2r6 UTSW 3 64538250 missense possibly damaging 0.73
R4227:Vmn2r6 UTSW 3 64537948 missense probably damaging 0.99
R4526:Vmn2r6 UTSW 3 64537724 missense probably benign 0.32
R4570:Vmn2r6 UTSW 3 64559647 missense probably benign 0.31
R4894:Vmn2r6 UTSW 3 64547408 missense probably benign
R4934:Vmn2r6 UTSW 3 64556345 missense probably damaging 0.99
R5057:Vmn2r6 UTSW 3 64537786 missense probably damaging 1.00
R5059:Vmn2r6 UTSW 3 64537623 missense possibly damaging 0.89
R5148:Vmn2r6 UTSW 3 64556594 missense probably damaging 0.99
R5155:Vmn2r6 UTSW 3 64538514 missense probably benign 0.44
R5179:Vmn2r6 UTSW 3 64537990 missense probably benign 0.00
R5256:Vmn2r6 UTSW 3 64556842 missense probably benign 0.33
R5861:Vmn2r6 UTSW 3 64556033 missense probably benign 0.00
R5950:Vmn2r6 UTSW 3 64565231 missense probably benign 0.05
R6081:Vmn2r6 UTSW 3 64556532 missense probably benign 0.25
R6173:Vmn2r6 UTSW 3 64559755 missense probably damaging 1.00
R6190:Vmn2r6 UTSW 3 64538003 missense probably benign 0.04
R6240:Vmn2r6 UTSW 3 64556805 missense probably damaging 1.00
R6433:Vmn2r6 UTSW 3 64547380 nonsense probably null
R6645:Vmn2r6 UTSW 3 64556876 missense probably damaging 1.00
R6791:Vmn2r6 UTSW 3 64538159 missense probably damaging 1.00
R7265:Vmn2r6 UTSW 3 64556774 missense probably benign 0.00
R7503:Vmn2r6 UTSW 3 64539951 nonsense probably null
R7562:Vmn2r6 UTSW 3 64556520 missense probably benign 0.00
R7584:Vmn2r6 UTSW 3 64565262 missense probably benign 0.07
R7611:Vmn2r6 UTSW 3 64565142 missense probably damaging 0.98
R7759:Vmn2r6 UTSW 3 64556570 missense probably damaging 1.00
R7834:Vmn2r6 UTSW 3 64538022 missense probably damaging 1.00
R7933:Vmn2r6 UTSW 3 64559803 missense probably benign 0.02
R7982:Vmn2r6 UTSW 3 64559820 missense probably damaging 1.00
R8024:Vmn2r6 UTSW 3 64559824 missense probably benign 0.40
R8074:Vmn2r6 UTSW 3 64547643 intron probably benign
R8169:Vmn2r6 UTSW 3 64539889 missense probably benign 0.01
R8736:Vmn2r6 UTSW 3 64559800 missense probably damaging 1.00
X0020:Vmn2r6 UTSW 3 64538450 missense probably benign
X0066:Vmn2r6 UTSW 3 64547378 missense probably damaging 1.00
Z1176:Vmn2r6 UTSW 3 64556325 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GTCACCCAGACATGTTTTGATG -3'
(R):5'- AGCACTGTGCCATACAATGTG -3'

Sequencing Primer
(F):5'- CACATGGAAGCAAATTAGCAGTTTC -3'
(R):5'- TGTGCCATACAATGTGGACCAC -3'
Posted On2020-09-02