Incidental Mutation 'R0070:Gm4787'
ID 64467
Institutional Source Beutler Lab
Gene Symbol Gm4787
Ensembl Gene ENSMUSG00000072974
Gene Name predicted gene 4787
Synonyms
MMRRC Submission 038361-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.058) question?
Stock # R0070 (G1)
Quality Score 150
Status Validated
Chromosome 12
Chromosomal Location 81423765-81426238 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 81425840 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 106 (D106V)
Ref Sequence ENSEMBL: ENSMUSP00000077390 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062182] [ENSMUST00000110340] [ENSMUST00000164386] [ENSMUST00000166723]
AlphaFold B2RUD9
Predicted Effect probably damaging
Transcript: ENSMUST00000062182
AA Change: D106V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000077390
Gene: ENSMUSG00000072974
AA Change: D106V

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
Pfam:Pep_M12B_propep 46 163 1.5e-19 PFAM
Pfam:Reprolysin 213 406 4.6e-18 PFAM
DISIN 425 500 2e-33 SMART
ACR 501 644 2.83e-53 SMART
transmembrane domain 714 736 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110340
SMART Domains Protein: ENSMUSP00000105969
Gene: ENSMUSG00000091803

DomainStartEndE-ValueType
Pfam:COX16 16 74 6.6e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164386
SMART Domains Protein: ENSMUSP00000132941
Gene: ENSMUSG00000021139

DomainStartEndE-ValueType
PDZ 21 100 6.16e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166723
SMART Domains Protein: ENSMUSP00000130935
Gene: ENSMUSG00000091803

DomainStartEndE-ValueType
Pfam:COX16 16 73 6.9e-16 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 96.1%
Validation Efficiency 97% (68/70)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgre4 T C 17: 56,109,154 (GRCm39) I387T probably damaging Het
Alpi A G 1: 87,028,881 (GRCm39) probably benign Het
Ankfn1 A T 11: 89,283,128 (GRCm39) L173Q probably damaging Het
Atp2a1 T C 7: 126,046,624 (GRCm39) E892G probably benign Het
AU018091 T C 7: 3,208,738 (GRCm39) probably null Het
Capn12 T C 7: 28,588,551 (GRCm39) probably benign Het
Capn2 C A 1: 182,301,434 (GRCm39) probably benign Het
Cd79b A G 11: 106,202,744 (GRCm39) probably benign Het
Cdh20 C T 1: 110,026,102 (GRCm39) A446V probably benign Het
Ciapin1 T C 8: 95,551,847 (GRCm39) N246S possibly damaging Het
Cmip T A 8: 118,153,293 (GRCm39) I270N probably damaging Het
Cyp2d40 A G 15: 82,644,975 (GRCm39) V225A unknown Het
Dnah9 A G 11: 66,050,866 (GRCm39) V142A probably benign Het
Dnai4 A T 4: 102,917,131 (GRCm39) I571K probably damaging Het
Flt3 A G 5: 147,309,536 (GRCm39) probably benign Het
Gm10238 A G 15: 75,109,434 (GRCm39) noncoding transcript Het
Hipk2 G A 6: 38,795,919 (GRCm39) R117* probably null Het
Hycc1 T C 5: 24,169,997 (GRCm39) S451G probably damaging Het
Ifna11 A G 4: 88,738,512 (GRCm39) D106G possibly damaging Het
Igkv1-115 G A 6: 68,138,402 (GRCm39) V2I probably benign Het
Itga6 T C 2: 71,657,060 (GRCm39) probably benign Het
Kcnj6 C A 16: 94,742,056 (GRCm39) K5N probably benign Het
Kcnt1 T C 2: 25,782,374 (GRCm39) V191A probably benign Het
Lcorl G A 5: 45,891,043 (GRCm39) R437C probably damaging Het
Man2a1 G A 17: 64,966,074 (GRCm39) probably null Het
Map3k14 T A 11: 103,130,380 (GRCm39) probably null Het
Mtch1 T A 17: 29,559,033 (GRCm39) probably benign Het
Myo1c A G 11: 75,551,076 (GRCm39) N217S probably benign Het
Or2h15 A G 17: 38,441,780 (GRCm39) L101P probably damaging Het
Or2w4 T C 13: 21,795,431 (GRCm39) K236R possibly damaging Het
Orm3 A G 4: 63,274,883 (GRCm39) T64A probably benign Het
Phf20l1 T G 15: 66,511,840 (GRCm39) W940G probably damaging Het
Phldb1 C T 9: 44,619,201 (GRCm39) R844H probably damaging Het
Piezo2 T C 18: 63,235,155 (GRCm39) D814G probably damaging Het
Pkd2 T C 5: 104,614,856 (GRCm39) C233R probably damaging Het
Prkd3 A G 17: 79,261,939 (GRCm39) Y792H probably damaging Het
Pth1r A T 9: 110,556,618 (GRCm39) probably null Het
Pxdn T C 12: 30,032,726 (GRCm39) L146S probably damaging Het
Rnf32 A G 5: 29,430,125 (GRCm39) T315A probably benign Het
Rpl5 T C 5: 108,049,766 (GRCm39) Y12H probably benign Het
Serpinh1 A T 7: 98,998,521 (GRCm39) S36R probably damaging Het
Setx A T 2: 29,051,537 (GRCm39) T2030S probably benign Het
Sf3a3 G A 4: 124,608,748 (GRCm39) V21I probably benign Het
Sin3b T A 8: 73,452,210 (GRCm39) H105Q probably damaging Het
Slitrk1 T C 14: 109,150,749 (GRCm39) probably benign Het
Slx4 A T 16: 3,805,880 (GRCm39) D557E possibly damaging Het
Sprr3 C T 3: 92,364,609 (GRCm39) M78I probably benign Het
Ssmem1 A G 6: 30,519,420 (GRCm39) E35G possibly damaging Het
Stag1 C T 9: 100,838,461 (GRCm39) P1238S probably null Het
Stra6 C T 9: 58,059,898 (GRCm39) probably benign Het
Tmem127 T C 2: 127,098,979 (GRCm39) V171A probably damaging Het
Tmem150a A G 6: 72,335,742 (GRCm39) probably null Het
Top2a C G 11: 98,905,886 (GRCm39) probably null Het
Ttn T C 2: 76,644,771 (GRCm39) probably null Het
Tusc3 G A 8: 39,530,421 (GRCm39) G129R possibly damaging Het
Uspl1 A G 5: 149,146,515 (GRCm39) Y422C probably damaging Het
Vmn2r88 A T 14: 51,651,597 (GRCm39) T312S probably benign Het
Zc3hav1l A T 6: 38,272,125 (GRCm39) S215T probably damaging Het
Zfp947 T A 17: 22,365,165 (GRCm39) T170S probably benign Het
Other mutations in Gm4787
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01719:Gm4787 APN 12 81,423,948 (GRCm39) missense possibly damaging 0.50
IGL01916:Gm4787 APN 12 81,424,218 (GRCm39) missense probably benign 0.36
IGL02193:Gm4787 APN 12 81,425,302 (GRCm39) missense probably benign 0.02
IGL02623:Gm4787 APN 12 81,425,502 (GRCm39) missense probably damaging 1.00
IGL02681:Gm4787 APN 12 81,425,543 (GRCm39) missense possibly damaging 0.88
IGL03257:Gm4787 APN 12 81,424,826 (GRCm39) missense probably damaging 1.00
IGL03410:Gm4787 APN 12 81,425,948 (GRCm39) missense probably damaging 1.00
F5770:Gm4787 UTSW 12 81,424,341 (GRCm39) nonsense probably null
PIT4362001:Gm4787 UTSW 12 81,423,949 (GRCm39) missense probably benign
R0128:Gm4787 UTSW 12 81,424,521 (GRCm39) nonsense probably null
R0220:Gm4787 UTSW 12 81,425,422 (GRCm39) missense probably damaging 0.98
R0304:Gm4787 UTSW 12 81,425,708 (GRCm39) missense probably damaging 1.00
R0513:Gm4787 UTSW 12 81,425,086 (GRCm39) missense probably benign 0.03
R1761:Gm4787 UTSW 12 81,423,950 (GRCm39) missense probably benign 0.02
R1809:Gm4787 UTSW 12 81,425,303 (GRCm39) missense possibly damaging 0.91
R1853:Gm4787 UTSW 12 81,425,108 (GRCm39) missense probably damaging 1.00
R1854:Gm4787 UTSW 12 81,425,108 (GRCm39) missense probably damaging 1.00
R2030:Gm4787 UTSW 12 81,425,544 (GRCm39) missense probably damaging 1.00
R2063:Gm4787 UTSW 12 81,425,694 (GRCm39) missense probably benign 0.39
R2112:Gm4787 UTSW 12 81,424,607 (GRCm39) missense probably damaging 1.00
R2140:Gm4787 UTSW 12 81,425,336 (GRCm39) missense probably benign 0.03
R2151:Gm4787 UTSW 12 81,423,993 (GRCm39) missense probably benign 0.00
R2152:Gm4787 UTSW 12 81,423,993 (GRCm39) missense probably benign 0.00
R2342:Gm4787 UTSW 12 81,425,532 (GRCm39) missense possibly damaging 0.91
R2504:Gm4787 UTSW 12 81,425,911 (GRCm39) missense possibly damaging 0.93
R4038:Gm4787 UTSW 12 81,425,132 (GRCm39) missense probably damaging 1.00
R4604:Gm4787 UTSW 12 81,425,987 (GRCm39) missense probably benign 0.17
R4748:Gm4787 UTSW 12 81,424,830 (GRCm39) missense probably damaging 1.00
R4750:Gm4787 UTSW 12 81,425,141 (GRCm39) missense possibly damaging 0.95
R4928:Gm4787 UTSW 12 81,425,612 (GRCm39) missense probably benign 0.03
R4960:Gm4787 UTSW 12 81,426,090 (GRCm39) missense probably damaging 0.99
R4974:Gm4787 UTSW 12 81,424,403 (GRCm39) missense probably damaging 0.99
R5028:Gm4787 UTSW 12 81,424,604 (GRCm39) missense probably benign 0.01
R5029:Gm4787 UTSW 12 81,424,604 (GRCm39) missense probably benign 0.01
R5031:Gm4787 UTSW 12 81,424,604 (GRCm39) missense probably benign 0.01
R5098:Gm4787 UTSW 12 81,424,604 (GRCm39) missense probably benign 0.01
R5099:Gm4787 UTSW 12 81,424,604 (GRCm39) missense probably benign 0.01
R5100:Gm4787 UTSW 12 81,424,604 (GRCm39) missense probably benign 0.01
R5101:Gm4787 UTSW 12 81,424,604 (GRCm39) missense probably benign 0.01
R5135:Gm4787 UTSW 12 81,424,604 (GRCm39) missense probably benign 0.01
R5152:Gm4787 UTSW 12 81,425,451 (GRCm39) missense probably benign 0.02
R5180:Gm4787 UTSW 12 81,424,604 (GRCm39) missense probably benign 0.01
R5220:Gm4787 UTSW 12 81,424,604 (GRCm39) missense probably benign 0.01
R5257:Gm4787 UTSW 12 81,424,604 (GRCm39) missense probably benign 0.01
R5258:Gm4787 UTSW 12 81,424,604 (GRCm39) missense probably benign 0.01
R5297:Gm4787 UTSW 12 81,424,604 (GRCm39) missense probably benign 0.01
R5324:Gm4787 UTSW 12 81,424,604 (GRCm39) missense probably benign 0.01
R5325:Gm4787 UTSW 12 81,424,604 (GRCm39) missense probably benign 0.01
R5355:Gm4787 UTSW 12 81,424,239 (GRCm39) nonsense probably null
R5364:Gm4787 UTSW 12 81,424,604 (GRCm39) missense probably benign 0.01
R5396:Gm4787 UTSW 12 81,424,604 (GRCm39) missense probably benign 0.01
R5397:Gm4787 UTSW 12 81,424,604 (GRCm39) missense probably benign 0.01
R5398:Gm4787 UTSW 12 81,424,604 (GRCm39) missense probably benign 0.01
R5514:Gm4787 UTSW 12 81,425,102 (GRCm39) missense possibly damaging 0.90
R5634:Gm4787 UTSW 12 81,424,604 (GRCm39) missense probably benign 0.01
R5666:Gm4787 UTSW 12 81,424,805 (GRCm39) missense probably benign 0.23
R5670:Gm4787 UTSW 12 81,424,805 (GRCm39) missense probably benign 0.23
R5787:Gm4787 UTSW 12 81,424,604 (GRCm39) missense probably benign 0.01
R5788:Gm4787 UTSW 12 81,424,604 (GRCm39) missense probably benign 0.01
R6354:Gm4787 UTSW 12 81,424,755 (GRCm39) missense probably damaging 1.00
R6932:Gm4787 UTSW 12 81,425,974 (GRCm39) missense probably benign 0.04
R7120:Gm4787 UTSW 12 81,425,260 (GRCm39) missense probably benign 0.00
R7237:Gm4787 UTSW 12 81,424,442 (GRCm39) missense probably damaging 0.99
R7937:Gm4787 UTSW 12 81,424,679 (GRCm39) missense probably benign 0.01
R8022:Gm4787 UTSW 12 81,424,494 (GRCm39) missense possibly damaging 0.94
R8140:Gm4787 UTSW 12 81,424,925 (GRCm39) missense probably benign 0.00
R8314:Gm4787 UTSW 12 81,425,909 (GRCm39) missense probably damaging 1.00
R8480:Gm4787 UTSW 12 81,424,280 (GRCm39) missense probably damaging 1.00
R8498:Gm4787 UTSW 12 81,425,840 (GRCm39) missense probably damaging 1.00
R8515:Gm4787 UTSW 12 81,424,043 (GRCm39) missense probably benign 0.00
R9103:Gm4787 UTSW 12 81,425,489 (GRCm39) missense probably benign 0.06
R9457:Gm4787 UTSW 12 81,426,020 (GRCm39) missense probably damaging 1.00
R9557:Gm4787 UTSW 12 81,426,074 (GRCm39) nonsense probably null
R9608:Gm4787 UTSW 12 81,425,086 (GRCm39) missense probably benign 0.03
V7580:Gm4787 UTSW 12 81,424,341 (GRCm39) nonsense probably null
V7581:Gm4787 UTSW 12 81,424,341 (GRCm39) nonsense probably null
V7582:Gm4787 UTSW 12 81,424,341 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTTCCAGCGAGCTTAGTCTCTTCAG -3'
(R):5'- TTCCCCAGAGAATGGGCAAAAGTG -3'

Sequencing Primer
(F):5'- AGTCTCTTCAGGGAGGTTACCTAC -3'
(R):5'- CCAGAGAATGGGCAAAAGTGATATG -3'
Posted On 2013-08-06