Incidental Mutation 'R8337:Rapgef6'
ID 644686
Institutional Source Beutler Lab
Gene Symbol Rapgef6
Ensembl Gene ENSMUSG00000037533
Gene Name Rap guanine nucleotide exchange factor (GEF) 6
Synonyms PDZ-GEF2, C030018K18Rik, Pdzgef2, RA-GEF-2
MMRRC Submission 067800-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8337 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 54413673-54590111 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 54522127 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Stop codon at position 455 (L455*)
Ref Sequence ENSEMBL: ENSMUSP00000104523 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094536] [ENSMUST00000101206] [ENSMUST00000102743] [ENSMUST00000108894] [ENSMUST00000108895] [ENSMUST00000207429] [ENSMUST00000218995]
AlphaFold Q5NCJ1
Predicted Effect probably null
Transcript: ENSMUST00000094536
AA Change: L170*
SMART Domains Protein: ENSMUSP00000092114
Gene: ENSMUSG00000037533
AA Change: L170*

DomainStartEndE-ValueType
cNMP 1 113 6.64e-7 SMART
RasGEFN 127 240 4.35e-33 SMART
PDZ 255 327 8.86e-16 SMART
low complexity region 409 420 N/A INTRINSIC
RA 464 550 1.47e-20 SMART
RasGEF 571 853 3.88e-84 SMART
low complexity region 944 957 N/A INTRINSIC
low complexity region 972 989 N/A INTRINSIC
low complexity region 1016 1061 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000101206
AA Change: L455*
SMART Domains Protein: ENSMUSP00000098766
Gene: ENSMUSG00000037533
AA Change: L455*

DomainStartEndE-ValueType
internal_repeat_1 10 82 1.45e-5 PROSPERO
low complexity region 187 205 N/A INTRINSIC
low complexity region 231 239 N/A INTRINSIC
cNMP 280 398 4.8e-13 SMART
RasGEFN 412 525 4.35e-33 SMART
PDZ 540 612 8.86e-16 SMART
low complexity region 694 705 N/A INTRINSIC
RA 749 835 1.47e-20 SMART
RasGEF 856 1095 5.35e-87 SMART
low complexity region 1237 1250 N/A INTRINSIC
low complexity region 1270 1293 N/A INTRINSIC
low complexity region 1345 1364 N/A INTRINSIC
low complexity region 1368 1380 N/A INTRINSIC
low complexity region 1444 1452 N/A INTRINSIC
low complexity region 1555 1568 N/A INTRINSIC
low complexity region 1591 1604 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000102743
AA Change: L455*
SMART Domains Protein: ENSMUSP00000099804
Gene: ENSMUSG00000037533
AA Change: L455*

DomainStartEndE-ValueType
internal_repeat_1 10 82 1.42e-5 PROSPERO
low complexity region 187 205 N/A INTRINSIC
low complexity region 231 239 N/A INTRINSIC
cNMP 280 398 4.8e-13 SMART
RasGEFN 412 525 4.35e-33 SMART
PDZ 540 612 8.86e-16 SMART
low complexity region 694 705 N/A INTRINSIC
RA 749 835 1.47e-20 SMART
RasGEF 856 1138 3.88e-84 SMART
low complexity region 1229 1242 N/A INTRINSIC
low complexity region 1262 1285 N/A INTRINSIC
low complexity region 1337 1356 N/A INTRINSIC
low complexity region 1360 1372 N/A INTRINSIC
low complexity region 1436 1444 N/A INTRINSIC
low complexity region 1547 1560 N/A INTRINSIC
low complexity region 1583 1596 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000108894
AA Change: L170*
SMART Domains Protein: ENSMUSP00000104522
Gene: ENSMUSG00000037533
AA Change: L170*

DomainStartEndE-ValueType
cNMP 1 113 6.64e-7 SMART
RasGEFN 127 240 4.35e-33 SMART
PDZ 255 327 8.86e-16 SMART
low complexity region 409 420 N/A INTRINSIC
RA 464 550 1.47e-20 SMART
RasGEF 571 810 5.35e-87 SMART
low complexity region 952 965 N/A INTRINSIC
low complexity region 980 997 N/A INTRINSIC
low complexity region 1024 1069 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000108895
AA Change: L455*
SMART Domains Protein: ENSMUSP00000104523
Gene: ENSMUSG00000037533
AA Change: L455*

DomainStartEndE-ValueType
internal_repeat_1 10 82 1.95e-5 PROSPERO
low complexity region 187 205 N/A INTRINSIC
low complexity region 231 239 N/A INTRINSIC
cNMP 280 398 4.8e-13 SMART
RasGEFN 412 526 1.03e-25 SMART
Predicted Effect probably null
Transcript: ENSMUST00000207429
AA Change: L455*
Predicted Effect probably null
Transcript: ENSMUST00000218995
AA Change: L308*
Meta Mutation Damage Score 0.9754 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency 100% (55/55)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit an inlarged spleen, increased IgE and IgG levels and altered cytokine production. [provided by MGI curators]
Allele List at MGI

All alleles(16) : Targeted, knock-out(1) Targeted, other(2) Gene trapped(13)

Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310034C09Rik T C 16: 88,556,151 (GRCm39) Y122H probably damaging Het
Abhd14b T A 9: 106,327,240 (GRCm39) H7Q probably benign Het
Acod1 C T 14: 103,286,780 (GRCm39) R28W possibly damaging Het
Agap2 A G 10: 126,924,194 (GRCm39) T803A unknown Het
Angptl7 T C 4: 148,581,741 (GRCm39) E215G probably damaging Het
Ankrd34c T A 9: 89,611,951 (GRCm39) D130V probably damaging Het
BC028528 A G 3: 95,792,298 (GRCm39) V144A probably benign Het
Cab39l T C 14: 59,776,640 (GRCm39) F274L probably damaging Het
Cdsn T C 17: 35,866,415 (GRCm39) S315P possibly damaging Het
Celsr3 CGGGG CGGGGG 9: 108,718,471 (GRCm39) probably null Het
Cep97 A T 16: 55,735,394 (GRCm39) L540* probably null Het
Chrna2 G T 14: 66,387,017 (GRCm39) E388* probably null Het
Ckap4 A G 10: 84,364,460 (GRCm39) V201A probably damaging Het
Clec4b1 A G 6: 123,042,922 (GRCm39) K47R probably benign Het
Clvs2 A T 10: 33,404,484 (GRCm39) I244N possibly damaging Het
Cmtr1 G A 17: 29,893,151 (GRCm39) E57K probably benign Het
Cxxc1 T A 18: 74,353,910 (GRCm39) D565E possibly damaging Het
Dtx3l T A 16: 35,754,073 (GRCm39) M178L probably benign Het
Eml2 A G 7: 18,930,161 (GRCm39) D294G possibly damaging Het
Flt3 A G 5: 147,269,698 (GRCm39) probably null Het
Frs3 T A 17: 48,014,777 (GRCm39) L490Q probably damaging Het
Gm6882 G A 7: 21,161,559 (GRCm39) T103I possibly damaging Het
Gsdmd C T 15: 75,736,270 (GRCm39) T133I probably benign Het
Hhipl2 C A 1: 183,209,540 (GRCm39) C331* probably null Het
Ifnar1 C A 16: 91,302,224 (GRCm39) D566E possibly damaging Het
Ighv1-34 A T 12: 114,814,939 (GRCm39) N74K probably benign Het
Itk T C 11: 46,233,222 (GRCm39) probably null Het
Kdm7a T C 6: 39,122,461 (GRCm39) D801G probably benign Het
Marchf1 T C 8: 66,871,641 (GRCm39) L139P probably damaging Het
Metap1d T C 2: 71,345,982 (GRCm39) V181A probably damaging Het
Mfsd8 G A 3: 40,789,628 (GRCm39) R140C probably damaging Het
Mrps25 T C 6: 92,152,745 (GRCm39) T92A probably benign Het
Mucl3 T C 17: 35,948,486 (GRCm39) H371R possibly damaging Het
Ntng2 C A 2: 29,138,050 (GRCm39) M1I probably null Het
Or51b17 C T 7: 103,542,256 (GRCm39) G229R probably benign Het
Or51q1 A C 7: 103,628,581 (GRCm39) M61L probably damaging Het
Or8b57 T C 9: 40,003,695 (GRCm39) K189R probably benign Het
Pla2g12a A G 3: 129,672,465 (GRCm39) D33G probably damaging Het
Prlhr A G 19: 60,456,284 (GRCm39) V94A possibly damaging Het
Ralgapb T A 2: 158,292,192 (GRCm39) S793T probably benign Het
Sbf2 T C 7: 110,040,669 (GRCm39) H386R probably benign Het
Sec23ip C A 7: 128,365,749 (GRCm39) N539K probably damaging Het
Shisa4 A G 1: 135,300,907 (GRCm39) L121P probably damaging Het
Slc28a2b C T 2: 122,355,617 (GRCm39) T603I probably benign Het
Stard9 T A 2: 120,510,306 (GRCm39) F296I probably damaging Het
Strn3 T C 12: 51,707,955 (GRCm39) K147E probably damaging Het
Taf5l T C 8: 124,724,841 (GRCm39) N326S probably benign Het
Tfb2m T A 1: 179,369,914 (GRCm39) I170L probably benign Het
Tfec T C 6: 16,845,422 (GRCm39) N79S possibly damaging Het
Tnn C T 1: 159,946,053 (GRCm39) G922R probably damaging Het
Tox3 T C 8: 91,074,507 (GRCm39) Y24C probably damaging Het
Vmn2r6 A T 3: 64,463,526 (GRCm39) L436* probably null Het
Vmn2r80 A G 10: 78,984,707 (GRCm39) I20V probably benign Het
Wdr97 T C 15: 76,245,684 (GRCm39) V1307A Het
Other mutations in Rapgef6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00436:Rapgef6 APN 11 54,570,091 (GRCm39) missense probably benign 0.00
IGL00507:Rapgef6 APN 11 54,554,935 (GRCm39) nonsense probably null
IGL00809:Rapgef6 APN 11 54,540,126 (GRCm39) missense probably damaging 1.00
IGL00843:Rapgef6 APN 11 54,582,099 (GRCm39) missense probably benign 0.03
IGL00899:Rapgef6 APN 11 54,510,844 (GRCm39) nonsense probably null
IGL01372:Rapgef6 APN 11 54,559,437 (GRCm39) splice site probably benign
IGL01604:Rapgef6 APN 11 54,585,389 (GRCm39) missense probably damaging 0.99
IGL01935:Rapgef6 APN 11 54,501,668 (GRCm39) missense possibly damaging 0.78
IGL01991:Rapgef6 APN 11 54,443,695 (GRCm39) missense probably benign 0.37
IGL02243:Rapgef6 APN 11 54,567,226 (GRCm39) missense probably damaging 1.00
IGL02407:Rapgef6 APN 11 54,567,181 (GRCm39) missense possibly damaging 0.91
IGL02676:Rapgef6 APN 11 54,540,172 (GRCm39) unclassified probably benign
IGL02934:Rapgef6 APN 11 54,516,690 (GRCm39) missense probably damaging 1.00
IGL03076:Rapgef6 APN 11 54,516,793 (GRCm39) missense probably damaging 1.00
IGL03110:Rapgef6 APN 11 54,586,915 (GRCm39) missense probably damaging 0.97
IGL03256:Rapgef6 APN 11 54,548,255 (GRCm39) missense probably damaging 1.00
shocker UTSW 11 54,510,842 (GRCm39) missense probably damaging 1.00
D4216:Rapgef6 UTSW 11 54,559,572 (GRCm39) splice site probably benign
PIT4305001:Rapgef6 UTSW 11 54,570,203 (GRCm39) missense probably damaging 1.00
PIT4366001:Rapgef6 UTSW 11 54,582,446 (GRCm39) missense probably damaging 0.98
R0047:Rapgef6 UTSW 11 54,437,204 (GRCm39) missense possibly damaging 0.65
R0047:Rapgef6 UTSW 11 54,437,204 (GRCm39) missense possibly damaging 0.65
R0125:Rapgef6 UTSW 11 54,516,701 (GRCm39) nonsense probably null
R0189:Rapgef6 UTSW 11 54,582,075 (GRCm39) missense probably benign
R0201:Rapgef6 UTSW 11 54,510,767 (GRCm39) missense probably damaging 1.00
R0505:Rapgef6 UTSW 11 54,516,789 (GRCm39) missense probably benign 0.00
R0524:Rapgef6 UTSW 11 54,581,110 (GRCm39) missense probably benign 0.32
R0853:Rapgef6 UTSW 11 54,559,503 (GRCm39) missense probably damaging 1.00
R1203:Rapgef6 UTSW 11 54,582,525 (GRCm39) missense probably benign 0.09
R1440:Rapgef6 UTSW 11 54,517,534 (GRCm39) missense probably damaging 1.00
R1453:Rapgef6 UTSW 11 54,530,553 (GRCm39) splice site probably null
R1530:Rapgef6 UTSW 11 54,552,009 (GRCm39) missense probably damaging 1.00
R1593:Rapgef6 UTSW 11 54,437,223 (GRCm39) frame shift probably null
R1620:Rapgef6 UTSW 11 54,517,420 (GRCm39) missense possibly damaging 0.88
R1628:Rapgef6 UTSW 11 54,437,223 (GRCm39) frame shift probably null
R1629:Rapgef6 UTSW 11 54,437,223 (GRCm39) frame shift probably null
R1630:Rapgef6 UTSW 11 54,437,223 (GRCm39) frame shift probably null
R1634:Rapgef6 UTSW 11 54,437,223 (GRCm39) frame shift probably null
R1640:Rapgef6 UTSW 11 54,548,231 (GRCm39) missense probably damaging 1.00
R1686:Rapgef6 UTSW 11 54,582,458 (GRCm39) missense possibly damaging 0.81
R1722:Rapgef6 UTSW 11 54,437,223 (GRCm39) frame shift probably null
R1743:Rapgef6 UTSW 11 54,567,110 (GRCm39) missense probably damaging 1.00
R1816:Rapgef6 UTSW 11 54,585,314 (GRCm39) missense probably benign
R1851:Rapgef6 UTSW 11 54,533,637 (GRCm39) missense probably benign 0.01
R1852:Rapgef6 UTSW 11 54,533,637 (GRCm39) missense probably benign 0.01
R1868:Rapgef6 UTSW 11 54,437,223 (GRCm39) frame shift probably null
R1888:Rapgef6 UTSW 11 54,551,654 (GRCm39) missense probably damaging 1.00
R1888:Rapgef6 UTSW 11 54,551,654 (GRCm39) missense probably damaging 1.00
R1942:Rapgef6 UTSW 11 54,548,089 (GRCm39) missense possibly damaging 0.95
R1943:Rapgef6 UTSW 11 54,548,089 (GRCm39) missense possibly damaging 0.95
R2031:Rapgef6 UTSW 11 54,443,684 (GRCm39) missense probably benign 0.30
R2087:Rapgef6 UTSW 11 54,522,075 (GRCm39) missense probably damaging 1.00
R2106:Rapgef6 UTSW 11 54,559,512 (GRCm39) missense probably benign 0.17
R2362:Rapgef6 UTSW 11 54,585,098 (GRCm39) missense probably damaging 1.00
R2484:Rapgef6 UTSW 11 54,533,582 (GRCm39) missense possibly damaging 0.48
R2566:Rapgef6 UTSW 11 54,578,537 (GRCm39) missense possibly damaging 0.66
R2872:Rapgef6 UTSW 11 54,552,001 (GRCm39) missense probably damaging 1.00
R2872:Rapgef6 UTSW 11 54,552,001 (GRCm39) missense probably damaging 1.00
R3744:Rapgef6 UTSW 11 54,516,760 (GRCm39) missense probably benign 0.40
R3848:Rapgef6 UTSW 11 54,582,134 (GRCm39) missense probably damaging 0.97
R4823:Rapgef6 UTSW 11 54,585,326 (GRCm39) missense probably benign 0.08
R4859:Rapgef6 UTSW 11 54,526,989 (GRCm39) missense probably benign
R4906:Rapgef6 UTSW 11 54,443,662 (GRCm39) missense probably damaging 1.00
R4911:Rapgef6 UTSW 11 54,513,143 (GRCm39) missense probably damaging 0.97
R4937:Rapgef6 UTSW 11 54,548,143 (GRCm39) missense probably damaging 1.00
R5033:Rapgef6 UTSW 11 54,582,207 (GRCm39) missense possibly damaging 0.92
R5249:Rapgef6 UTSW 11 54,413,943 (GRCm39) missense probably benign 0.19
R5304:Rapgef6 UTSW 11 54,548,200 (GRCm39) missense probably benign 0.01
R5656:Rapgef6 UTSW 11 54,526,962 (GRCm39) missense possibly damaging 0.95
R5701:Rapgef6 UTSW 11 54,567,220 (GRCm39) missense possibly damaging 0.76
R5758:Rapgef6 UTSW 11 54,559,470 (GRCm39) missense probably damaging 1.00
R5973:Rapgef6 UTSW 11 54,530,609 (GRCm39) missense probably damaging 1.00
R6177:Rapgef6 UTSW 11 54,510,842 (GRCm39) missense probably damaging 1.00
R6268:Rapgef6 UTSW 11 54,540,073 (GRCm39) missense probably damaging 1.00
R6287:Rapgef6 UTSW 11 54,517,164 (GRCm39) splice site probably null
R6293:Rapgef6 UTSW 11 54,525,607 (GRCm39) missense probably damaging 1.00
R6471:Rapgef6 UTSW 11 54,582,563 (GRCm39) missense probably damaging 0.99
R6863:Rapgef6 UTSW 11 54,437,206 (GRCm39) missense probably benign 0.00
R6950:Rapgef6 UTSW 11 54,567,206 (GRCm39) missense probably benign 0.09
R7144:Rapgef6 UTSW 11 54,548,191 (GRCm39) missense possibly damaging 0.78
R7171:Rapgef6 UTSW 11 54,567,189 (GRCm39) missense possibly damaging 0.94
R7199:Rapgef6 UTSW 11 54,437,252 (GRCm39) missense probably benign 0.00
R7291:Rapgef6 UTSW 11 54,582,065 (GRCm39) missense probably benign 0.05
R7436:Rapgef6 UTSW 11 54,501,747 (GRCm39) critical splice donor site probably null
R7498:Rapgef6 UTSW 11 54,510,830 (GRCm39) missense probably damaging 1.00
R7506:Rapgef6 UTSW 11 54,526,997 (GRCm39) missense probably benign 0.00
R7527:Rapgef6 UTSW 11 54,525,787 (GRCm39) missense unknown
R7646:Rapgef6 UTSW 11 54,516,780 (GRCm39) missense probably benign 0.00
R7655:Rapgef6 UTSW 11 54,585,279 (GRCm39) missense probably benign 0.10
R7656:Rapgef6 UTSW 11 54,585,279 (GRCm39) missense probably benign 0.10
R7687:Rapgef6 UTSW 11 54,551,901 (GRCm39) missense possibly damaging 0.93
R7768:Rapgef6 UTSW 11 54,517,414 (GRCm39) missense probably damaging 1.00
R7788:Rapgef6 UTSW 11 54,585,225 (GRCm39) missense probably damaging 1.00
R7890:Rapgef6 UTSW 11 54,517,549 (GRCm39) missense probably damaging 1.00
R8113:Rapgef6 UTSW 11 54,516,784 (GRCm39) missense probably benign 0.03
R8393:Rapgef6 UTSW 11 54,578,487 (GRCm39) missense probably benign
R8465:Rapgef6 UTSW 11 54,582,308 (GRCm39) missense probably benign 0.00
R8492:Rapgef6 UTSW 11 54,581,063 (GRCm39) missense probably damaging 0.99
R8791:Rapgef6 UTSW 11 54,459,295 (GRCm39) missense probably benign 0.15
R8866:Rapgef6 UTSW 11 54,443,700 (GRCm39) critical splice donor site probably null
R8917:Rapgef6 UTSW 11 54,582,392 (GRCm39) nonsense probably null
R8921:Rapgef6 UTSW 11 54,570,065 (GRCm39) missense probably benign 0.09
R9031:Rapgef6 UTSW 11 54,578,667 (GRCm39) missense probably benign 0.00
R9093:Rapgef6 UTSW 11 54,487,912 (GRCm39) nonsense probably null
R9354:Rapgef6 UTSW 11 54,510,749 (GRCm39) missense possibly damaging 0.66
R9514:Rapgef6 UTSW 11 54,443,684 (GRCm39) missense probably benign 0.14
R9516:Rapgef6 UTSW 11 54,582,169 (GRCm39) missense probably damaging 1.00
R9739:Rapgef6 UTSW 11 54,513,189 (GRCm39) missense probably benign 0.03
R9789:Rapgef6 UTSW 11 54,540,097 (GRCm39) missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TGGGAAATAATGTGACACCTTGAG -3'
(R):5'- AGGCTCTTTCGTTAGTAAAATGACC -3'

Sequencing Primer
(F):5'- GAAATAATGTGACACCTTGAGTTTTG -3'
(R):5'- CTTTCGTTAGTAAAATGACCAAACAC -3'
Posted On 2020-09-02