Incidental Mutation 'R8338:Cfap157'
ID644714
Institutional Source Beutler Lab
Gene Symbol Cfap157
Ensembl Gene ENSMUSG00000038987
Gene Namecilia and flagella associated protein 157
Synonyms1700019L03Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.141) question?
Stock #R8338 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location32777381-32784428 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 32778006 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Asparagine at position 441 (T441N)
Ref Sequence ENSEMBL: ENSMUSP00000099877 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066352] [ENSMUST00000066478] [ENSMUST00000091059] [ENSMUST00000102813] [ENSMUST00000125891] [ENSMUST00000161089] [ENSMUST00000161430] [ENSMUST00000161950] [ENSMUST00000161958]
Predicted Effect probably benign
Transcript: ENSMUST00000066352
SMART Domains Protein: ENSMUSP00000068850
Gene: ENSMUSG00000053746

DomainStartEndE-ValueType
Pfam:Pept_tRNA_hydro 22 200 6.3e-39 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000066478
SMART Domains Protein: ENSMUSP00000068977
Gene: ENSMUSG00000039021

DomainStartEndE-ValueType
TPR 18 51 2.26e-3 SMART
TPR 52 85 4.09e-1 SMART
TPR 93 126 8.3e-2 SMART
TPR 161 194 4.44e1 SMART
TPR 208 241 3.69e1 SMART
TPR 242 275 1.08e1 SMART
Blast:TPR 288 321 2e-10 BLAST
TPR 322 355 1.02e-1 SMART
TPR 363 396 7.27e0 SMART
Blast:TPR 397 430 2e-12 BLAST
low complexity region 539 554 N/A INTRINSIC
low complexity region 565 577 N/A INTRINSIC
low complexity region 629 640 N/A INTRINSIC
low complexity region 725 750 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000091059
SMART Domains Protein: ENSMUSP00000088585
Gene: ENSMUSG00000039021

DomainStartEndE-ValueType
TPR 75 108 2.26e-3 SMART
TPR 109 142 4.09e-1 SMART
TPR 150 183 8.3e-2 SMART
TPR 218 251 4.44e1 SMART
TPR 265 298 3.69e1 SMART
TPR 299 332 1.08e1 SMART
Blast:TPR 345 378 2e-10 BLAST
TPR 379 412 1.02e-1 SMART
TPR 420 453 7.27e0 SMART
Blast:TPR 454 487 2e-12 BLAST
low complexity region 631 644 N/A INTRINSIC
low complexity region 666 679 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000102813
AA Change: T441N

PolyPhen 2 Score 0.538 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000099877
Gene: ENSMUSG00000038987
AA Change: T441N

DomainStartEndE-ValueType
coiled coil region 32 191 N/A INTRINSIC
coiled coil region 301 371 N/A INTRINSIC
low complexity region 402 416 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125891
Predicted Effect probably benign
Transcript: ENSMUST00000161089
SMART Domains Protein: ENSMUSP00000124915
Gene: ENSMUSG00000039021

DomainStartEndE-ValueType
TPR 18 51 2.26e-3 SMART
TPR 52 85 4.09e-1 SMART
TPR 93 126 8.3e-2 SMART
TPR 161 194 4.44e1 SMART
TPR 208 241 3.69e1 SMART
TPR 242 275 1.08e1 SMART
Blast:TPR 288 321 2e-10 BLAST
TPR 322 355 1.02e-1 SMART
TPR 363 396 7.27e0 SMART
Blast:TPR 397 430 2e-12 BLAST
low complexity region 539 554 N/A INTRINSIC
low complexity region 565 577 N/A INTRINSIC
low complexity region 629 640 N/A INTRINSIC
low complexity region 725 750 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161430
SMART Domains Protein: ENSMUSP00000124031
Gene: ENSMUSG00000039021

DomainStartEndE-ValueType
TPR 75 108 2.26e-3 SMART
TPR 109 142 4.09e-1 SMART
TPR 150 183 8.3e-2 SMART
TPR 218 251 4.44e1 SMART
TPR 265 298 3.69e1 SMART
TPR 299 332 1.08e1 SMART
Blast:TPR 345 378 2e-10 BLAST
TPR 379 412 1.02e-1 SMART
TPR 420 453 7.27e0 SMART
Blast:TPR 454 487 2e-12 BLAST
low complexity region 596 611 N/A INTRINSIC
low complexity region 622 634 N/A INTRINSIC
low complexity region 686 697 N/A INTRINSIC
low complexity region 782 807 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161950
SMART Domains Protein: ENSMUSP00000123927
Gene: ENSMUSG00000039021

DomainStartEndE-ValueType
TPR 18 51 2.26e-3 SMART
TPR 52 85 4.09e-1 SMART
TPR 93 126 8.3e-2 SMART
TPR 161 194 4.44e1 SMART
TPR 208 241 3.69e1 SMART
TPR 242 275 1.08e1 SMART
Blast:TPR 288 321 2e-10 BLAST
TPR 322 355 1.02e-1 SMART
TPR 363 396 7.27e0 SMART
Blast:TPR 397 430 2e-12 BLAST
low complexity region 539 554 N/A INTRINSIC
low complexity region 565 577 N/A INTRINSIC
low complexity region 629 640 N/A INTRINSIC
low complexity region 725 750 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161958
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous knockout males are infertile owing to reduced sperm count and reduced and abnormal sperm motility as a result of abnormal sperm morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ache T C 5: 137,291,744 L445P probably damaging Het
Agrn G A 4: 156,168,561 T1773I probably benign Het
Arap3 A G 18: 37,973,630 S1387P probably damaging Het
Bcl11a G C 11: 24,164,578 K640N probably damaging Het
Bicd1 G A 6: 149,513,123 V445I probably benign Het
C2cd6 A C 1: 59,060,575 N402K probably benign Het
Celsr3 C T 9: 108,827,340 Q341* probably null Het
Cers1 A G 8: 70,331,122 E240G possibly damaging Het
Cfap44 G A 16: 44,419,335 probably null Het
Chd1 A G 17: 15,769,980 Y1598C probably damaging Het
Ckap2l T G 2: 129,285,019 Q413P probably damaging Het
Cobl T C 11: 12,253,696 E1002G probably benign Het
Cryge G A 1: 65,048,774 T156M unknown Het
Cubn A C 2: 13,430,847 F1099L probably benign Het
Cyp7b1 T C 3: 18,097,566 E161G probably benign Het
Dnah10 A G 5: 124,832,502 E4452G probably damaging Het
Dnah2 C T 11: 69,487,296 R1273Q probably damaging Het
Dnah3 T C 7: 120,071,881 E593G probably benign Het
Dnah9 C A 11: 65,841,241 probably null Het
Dnajc22 C A 15: 99,101,141 P69Q probably benign Het
Fam171a2 T A 11: 102,438,346 D529V probably benign Het
Fbxl17 T C 17: 63,356,758 I579V possibly damaging Het
Fry C T 5: 150,359,051 T347M probably damaging Het
Gm13272 A C 4: 88,780,127 D93A probably benign Het
Gm428 T A 4: 73,687,198 M282K possibly damaging Het
Gm4778 A G 3: 94,265,978 I94V possibly damaging Het
Grm4 A T 17: 27,435,003 F658I probably damaging Het
Hmcn1 G A 1: 150,738,734 T1307I probably benign Het
Igkv12-98 G A 6: 68,571,175 S96N probably benign Het
Il2ra A T 2: 11,683,074 T222S probably benign Het
Il5ra G T 6: 106,712,389 T414K probably benign Het
Isg15 T A 4: 156,199,631 I147F probably benign Het
Kif14 C A 1: 136,494,678 A902E probably damaging Het
Lcat G A 8: 105,940,087 R268C probably damaging Het
Lipa T C 19: 34,494,077 N366S probably benign Het
Lrp4 A G 2: 91,492,368 T1101A probably benign Het
Man1a T A 10: 53,925,547 probably null Het
Mib1 A G 18: 10,726,372 D23G probably benign Het
Morc2b A T 17: 33,136,413 M795K probably benign Het
Mycbp2 T A 14: 103,135,265 E4048D probably damaging Het
Myo7b A G 18: 31,971,355 S1447P probably damaging Het
Myt1 A T 2: 181,801,862 T536S possibly damaging Het
Nod1 A T 6: 54,943,971 L454Q probably damaging Het
Nrf1 T A 6: 30,140,248 W199R Het
Olfr1065 A T 2: 86,445,385 M199K probably benign Het
Olfr1490 T A 19: 13,654,852 M141K possibly damaging Het
Olfr301 T C 7: 86,412,494 I44T probably benign Het
Olfr460 T C 6: 40,571,976 F197L probably benign Het
Olfr60 T A 7: 140,345,393 M199L probably benign Het
Ostn G T 16: 27,324,535 A38S probably benign Het
Paxbp1 A T 16: 91,036,547 D266E probably damaging Het
Pcdhb14 G T 18: 37,449,122 G427V probably damaging Het
Pdzrn3 A T 6: 101,150,822 M961K probably benign Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 probably benign Het
Prdx5 T C 19: 6,907,264 D148G probably damaging Het
Ptprj A T 2: 90,471,137 I217N possibly damaging Het
Rccd1 A T 7: 80,320,870 L54Q possibly damaging Het
Rfx6 T A 10: 51,718,094 V370E probably damaging Het
Sdr16c6 C T 4: 4,076,620 C93Y probably damaging Het
Shroom1 A G 11: 53,463,280 D9G probably benign Het
Snrpe A G 1: 133,608,943 V33A probably benign Het
Spats2 T A 15: 99,178,459 D139E probably damaging Het
St18 A G 1: 6,809,292 E405G probably damaging Het
Strap A T 6: 137,741,978 E176V possibly damaging Het
Stxbp5l G T 16: 37,174,356 T729K probably damaging Het
Synj2bp G A 12: 81,504,552 Q97* probably null Het
Tbc1d32 T A 10: 56,028,077 Q1198L possibly damaging Het
Tmem98 T C 11: 80,821,309 S191P probably benign Het
Tnn C T 1: 160,118,483 G922R probably damaging Het
Treh A G 9: 44,684,511 N366S probably benign Het
Ttn T G 2: 76,919,792 S3638R probably benign Het
Uggt1 A G 1: 36,227,521 L124P probably damaging Het
Uhrf1bp1 A G 17: 27,876,695 N26S probably damaging Het
V1rd19 A T 7: 24,003,249 K47* probably null Het
Wdhd1 T C 14: 47,268,663 M265V probably benign Het
Wsb1 T C 11: 79,246,277 D168G probably damaging Het
Other mutations in Cfap157
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00338:Cfap157 APN 2 32781383 missense probably damaging 1.00
IGL00852:Cfap157 APN 2 32779815 missense possibly damaging 0.89
IGL01284:Cfap157 APN 2 32781479 missense possibly damaging 0.69
IGL02315:Cfap157 APN 2 32778165 missense probably benign 0.02
PIT4810001:Cfap157 UTSW 2 32781432 missense probably damaging 0.96
R0654:Cfap157 UTSW 2 32779942 missense probably damaging 1.00
R0699:Cfap157 UTSW 2 32779010 missense probably damaging 1.00
R1103:Cfap157 UTSW 2 32781398 missense probably damaging 1.00
R1123:Cfap157 UTSW 2 32777923 missense possibly damaging 0.93
R2165:Cfap157 UTSW 2 32778163 splice site probably null
R4304:Cfap157 UTSW 2 32779042 missense probably damaging 1.00
R4307:Cfap157 UTSW 2 32779042 missense probably damaging 1.00
R4308:Cfap157 UTSW 2 32779042 missense probably damaging 1.00
R4439:Cfap157 UTSW 2 32777865 missense probably benign 0.00
R4859:Cfap157 UTSW 2 32777542 missense probably benign 0.00
R4880:Cfap157 UTSW 2 32778249 missense probably damaging 1.00
R4917:Cfap157 UTSW 2 32779953 missense probably benign 0.19
R5808:Cfap157 UTSW 2 32780645 missense probably damaging 1.00
R6052:Cfap157 UTSW 2 32779851 missense probably damaging 1.00
R6405:Cfap157 UTSW 2 32781396 missense probably damaging 1.00
R6502:Cfap157 UTSW 2 32780678 missense probably damaging 1.00
R6647:Cfap157 UTSW 2 32779074 missense probably benign
R6959:Cfap157 UTSW 2 32784248 missense probably damaging 1.00
R7123:Cfap157 UTSW 2 32779401 missense probably damaging 0.99
R7469:Cfap157 UTSW 2 32780684 missense probably damaging 1.00
R7527:Cfap157 UTSW 2 32779878 missense possibly damaging 0.86
R7573:Cfap157 UTSW 2 32777508 missense probably benign 0.00
R7697:Cfap157 UTSW 2 32779753 missense probably benign 0.01
R7911:Cfap157 UTSW 2 32778207 missense probably damaging 1.00
X0020:Cfap157 UTSW 2 32779855 missense probably benign 0.35
Z1177:Cfap157 UTSW 2 32778207 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTCTGGCAGATCCCCATTC -3'
(R):5'- GATGTGGTGTTCCAACTGCAG -3'

Sequencing Primer
(F):5'- CCATTCGGGTGATATAGGAGAG -3'
(R):5'- GCAACTGCTGGTATTGCTCAGC -3'
Posted On2020-09-02