Incidental Mutation 'R0070:Kcnj6'
ID64472
Institutional Source Beutler Lab
Gene Symbol Kcnj6
Ensembl Gene ENSMUSG00000043301
Gene Namepotassium inwardly-rectifying channel, subfamily J, member 6
SynonymsKCNJ7, GIRK2, Kir3.2
MMRRC Submission 038361-MU
Accession Numbers

Genbank: NM_001025584.2, NM_001025585.2, NM_001025590.1, NM_010606.2  

Is this an essential gene? Probably non essential (E-score: 0.087) question?
Stock #R0070 (G1)
Quality Score200
Status Validated
Chromosome16
Chromosomal Location94748636-94997701 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 94941197 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 5 (K5N)
Ref Sequence ENSEMBL: ENSMUSP00000097108 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095873] [ENSMUST00000099508]
Predicted Effect probably benign
Transcript: ENSMUST00000095873
AA Change: K5N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000093558
Gene: ENSMUSG00000043301
AA Change: K5N

DomainStartEndE-ValueType
Pfam:IRK 59 397 9.3e-166 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000099508
AA Change: K5N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000097108
Gene: ENSMUSG00000043301
AA Change: K5N

DomainStartEndE-ValueType
Pfam:IRK 59 382 8.5e-146 PFAM
low complexity region 396 411 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231744
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232128
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232403
Meta Mutation Damage Score 0.0586 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 96.1%
Validation Efficiency 97% (68/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the G protein-coupled inwardly-rectifying potassium channel family of inward rectifier potassium channels. This type of potassium channel allows a greater flow of potassium into the cell than out of it. These proteins modulate many physiological processes, including heart rate in cardiac cells and circuit activity in neuronal cells, through G-protein coupled receptor stimulation. Mutations in this gene are associated with Keppen-Lubinsky Syndrome, a rare condition characterized by severe developmental delay, facial dysmorphism, and intellectual disability. [provided by RefSeq, Apr 2015]
PHENOTYPE: A spontaneous mutation exhibits small size, ataxia, hypotonia, high periweaning mortality, Purkinje cell defects, and male sterility. Homozygotes for a targeted null mutation exhibit increased susceptibility to spontaneous and drug-induced seizures. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted, knock-out(1) Gene trapped(1) Spontaneous(1)

Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgre4 T C 17: 55,802,154 I387T probably damaging Het
Alpi A G 1: 87,101,159 probably benign Het
Ankfn1 A T 11: 89,392,302 L173Q probably damaging Het
Atp2a1 T C 7: 126,447,452 E892G probably benign Het
AU018091 T C 7: 3,158,898 probably null Het
Capn12 T C 7: 28,889,126 probably benign Het
Capn2 C A 1: 182,473,869 probably benign Het
Cd79b A G 11: 106,311,918 probably benign Het
Cdh7 C T 1: 110,098,372 A446V probably benign Het
Ciapin1 T C 8: 94,825,219 N246S possibly damaging Het
Cmip T A 8: 117,426,554 I270N probably damaging Het
Cyp2d40 A G 15: 82,760,774 V225A unknown Het
Dnah9 A G 11: 66,160,040 V142A probably benign Het
Fam126a T C 5: 23,964,999 S451G probably damaging Het
Flt3 A G 5: 147,372,726 probably benign Het
Gm10238 A G 15: 75,237,585 noncoding transcript Het
Gm4787 T A 12: 81,379,066 D106V probably damaging Het
Hipk2 G A 6: 38,818,984 R117* probably null Het
Ifna11 A G 4: 88,820,275 D106G possibly damaging Het
Igkv1-115 G A 6: 68,161,418 V2I probably benign Het
Itga6 T C 2: 71,826,716 probably benign Het
Kcnt1 T C 2: 25,892,362 V191A probably benign Het
Lcorl G A 5: 45,733,701 R437C probably damaging Het
Man2a1 G A 17: 64,659,079 probably null Het
Map3k14 T A 11: 103,239,554 probably null Het
Mtch1 T A 17: 29,340,059 probably benign Het
Myo1c A G 11: 75,660,250 N217S probably benign Het
Olfr132 A G 17: 38,130,889 L101P probably damaging Het
Olfr1362 T C 13: 21,611,261 K236R possibly damaging Het
Orm3 A G 4: 63,356,646 T64A probably benign Het
Phf20l1 T G 15: 66,639,991 W940G probably damaging Het
Phldb1 C T 9: 44,707,904 R844H probably damaging Het
Piezo2 T C 18: 63,102,084 D814G probably damaging Het
Pkd2 T C 5: 104,466,990 C233R probably damaging Het
Prkd3 A G 17: 78,954,510 Y792H probably damaging Het
Pth1r A T 9: 110,727,550 probably null Het
Pxdn T C 12: 29,982,727 L146S probably damaging Het
Rnf32 A G 5: 29,225,127 T315A probably benign Het
Rpl5 T C 5: 107,901,900 Y12H probably benign Het
Serpinh1 A T 7: 99,349,314 S36R probably damaging Het
Setx A T 2: 29,161,525 T2030S probably benign Het
Sf3a3 G A 4: 124,714,955 V21I probably benign Het
Sin3b T A 8: 72,725,582 H105Q probably damaging Het
Slitrk1 T C 14: 108,913,317 probably benign Het
Slx4 A T 16: 3,988,016 D557E possibly damaging Het
Sprr3 C T 3: 92,457,302 M78I probably benign Het
Ssmem1 A G 6: 30,519,421 E35G possibly damaging Het
Stag1 C T 9: 100,956,408 P1238S probably null Het
Stra6 C T 9: 58,152,615 probably benign Het
Tmem127 T C 2: 127,257,059 V171A probably damaging Het
Tmem150a A G 6: 72,358,759 probably null Het
Top2a C G 11: 99,015,060 probably null Het
Ttn T C 2: 76,814,427 probably null Het
Tusc3 G A 8: 39,063,267 G129R possibly damaging Het
Uspl1 A G 5: 149,209,705 Y422C probably damaging Het
Vmn2r88 A T 14: 51,414,140 T312S probably benign Het
Wdr78 A T 4: 103,059,934 I571K probably damaging Het
Zc3hav1l A T 6: 38,295,190 S215T probably damaging Het
Zfp947 T A 17: 22,146,184 T170S probably benign Het
Other mutations in Kcnj6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01309:Kcnj6 APN 16 94832455 missense probably damaging 0.99
IGL01433:Kcnj6 APN 16 94832955 missense probably benign 0.21
IGL01603:Kcnj6 APN 16 94833199 missense probably benign 0.00
IGL02212:Kcnj6 APN 16 94832487 missense probably damaging 1.00
IGL02982:Kcnj6 APN 16 94832517 missense possibly damaging 0.89
IGL03351:Kcnj6 APN 16 94832583 missense probably damaging 1.00
Seizure UTSW 16 94832659 missense probably damaging 1.00
H8477:Kcnj6 UTSW 16 94832937 missense probably damaging 1.00
IGL02796:Kcnj6 UTSW 16 94832919 missense probably benign 0.00
R1558:Kcnj6 UTSW 16 94762499 missense possibly damaging 0.57
R1676:Kcnj6 UTSW 16 94832584 missense probably damaging 1.00
R2435:Kcnj6 UTSW 16 94762679 missense probably damaging 0.99
R3700:Kcnj6 UTSW 16 94833006 missense probably damaging 0.96
R3800:Kcnj6 UTSW 16 94833027 missense probably damaging 1.00
R4012:Kcnj6 UTSW 16 94825018 splice site probably null
R4899:Kcnj6 UTSW 16 94832613 missense probably damaging 1.00
R5124:Kcnj6 UTSW 16 94832659 missense probably damaging 1.00
R5359:Kcnj6 UTSW 16 94832453 nonsense probably null
R5560:Kcnj6 UTSW 16 94832965 missense probably benign 0.06
R5583:Kcnj6 UTSW 16 94833201 missense probably benign 0.26
R6057:Kcnj6 UTSW 16 94832377 missense probably damaging 1.00
R6330:Kcnj6 UTSW 16 94762601 missense possibly damaging 0.93
R6582:Kcnj6 UTSW 16 94832826 missense possibly damaging 0.93
R6604:Kcnj6 UTSW 16 94762645 missense probably damaging 1.00
R6802:Kcnj6 UTSW 16 94762577 missense probably benign 0.06
R6866:Kcnj6 UTSW 16 94762677 missense probably damaging 1.00
R7304:Kcnj6 UTSW 16 94941183 missense probably benign
R7337:Kcnj6 UTSW 16 94833214 missense probably benign 0.10
R7396:Kcnj6 UTSW 16 94762447 missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- CGTGGATTCCCAACTCCAAAAGCAG -3'
(R):5'- AAGATCAGTGTGACAGCCGCTC -3'

Sequencing Primer
(F):5'- CCCAACCAAGTGGAATTTTGAG -3'
(R):5'- TCACTGCCAAGAGCAATGG -3'
Posted On2013-08-06