Incidental Mutation 'R0070:Prkd3'
Institutional Source Beutler Lab
Gene Symbol Prkd3
Ensembl Gene ENSMUSG00000024070
Gene Nameprotein kinase D3
SynonymsPrkcn, 5730497N19Rik, PKD3, 4930557O20Rik
MMRRC Submission 038361-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.146) question?
Stock #R0070 (G1)
Quality Score116
Status Validated
Chromosomal Location78949405-79020816 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 78954510 bp
Amino Acid Change Tyrosine to Histidine at position 792 (Y792H)
Ref Sequence ENSEMBL: ENSMUSP00000132004 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003191] [ENSMUST00000118768] [ENSMUST00000119284] [ENSMUST00000168887]
Predicted Effect probably damaging
Transcript: ENSMUST00000003191
AA Change: Y792H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000003191
Gene: ENSMUSG00000024070
AA Change: Y792H

C1 155 204 1.95e-13 SMART
C1 272 321 1.26e-16 SMART
PH 417 534 1.18e-10 SMART
S_TKc 575 831 4.5e-90 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000118768
AA Change: Y698H

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000113232
Gene: ENSMUSG00000024070
AA Change: Y698H

C1 60 109 1.95e-13 SMART
C1 177 226 1.26e-16 SMART
PH 322 439 1.18e-10 SMART
S_TKc 481 737 4.5e-90 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000119284
AA Change: Y793H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113395
Gene: ENSMUSG00000024070
AA Change: Y793H

C1 155 204 1.95e-13 SMART
C1 272 321 1.26e-16 SMART
PH 417 534 1.18e-10 SMART
S_TKc 576 832 4.5e-90 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000168887
AA Change: Y792H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000132004
Gene: ENSMUSG00000024070
AA Change: Y792H

C1 155 204 1.95e-13 SMART
C1 272 321 1.26e-16 SMART
PH 417 534 1.18e-10 SMART
S_TKc 575 831 4.5e-90 SMART
Meta Mutation Damage Score 0.7700 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 96.1%
Validation Efficiency 97% (68/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the multigene protein kinase D family of serine/threonine kinases, which bind diacylglycerol and phorbol esters. Members of this family are characterized by an N-terminal regulatory domain comprised of a tandem repeat of cysteine-rich zinc-finger motifs and a pleckstrin domain. The C-terminal region contains the catalytic domain and is distantly related to calcium-regulated kinases. Catalytic activity of this enzyme promotes its nuclear localization. This protein has been implicated in a variety of functions including negative regulation of human airway epithelial barrier formation, growth regulation of breast and prostate cancer cells, and vesicle trafficking. [provided by RefSeq, Jan 2015]
PHENOTYPE: Homozygous mutation of this gene results in abnormal vertebral trabecular bone morphology and abnormal femur morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgre4 T C 17: 55,802,154 I387T probably damaging Het
Alpi A G 1: 87,101,159 probably benign Het
Ankfn1 A T 11: 89,392,302 L173Q probably damaging Het
Atp2a1 T C 7: 126,447,452 E892G probably benign Het
AU018091 T C 7: 3,158,898 probably null Het
Capn12 T C 7: 28,889,126 probably benign Het
Capn2 C A 1: 182,473,869 probably benign Het
Cd79b A G 11: 106,311,918 probably benign Het
Cdh7 C T 1: 110,098,372 A446V probably benign Het
Ciapin1 T C 8: 94,825,219 N246S possibly damaging Het
Cmip T A 8: 117,426,554 I270N probably damaging Het
Cyp2d40 A G 15: 82,760,774 V225A unknown Het
Dnah9 A G 11: 66,160,040 V142A probably benign Het
Fam126a T C 5: 23,964,999 S451G probably damaging Het
Flt3 A G 5: 147,372,726 probably benign Het
Gm10238 A G 15: 75,237,585 noncoding transcript Het
Gm4787 T A 12: 81,379,066 D106V probably damaging Het
Hipk2 G A 6: 38,818,984 R117* probably null Het
Ifna11 A G 4: 88,820,275 D106G possibly damaging Het
Igkv1-115 G A 6: 68,161,418 V2I probably benign Het
Itga6 T C 2: 71,826,716 probably benign Het
Kcnj6 C A 16: 94,941,197 K5N probably benign Het
Kcnt1 T C 2: 25,892,362 V191A probably benign Het
Lcorl G A 5: 45,733,701 R437C probably damaging Het
Man2a1 G A 17: 64,659,079 probably null Het
Map3k14 T A 11: 103,239,554 probably null Het
Mtch1 T A 17: 29,340,059 probably benign Het
Myo1c A G 11: 75,660,250 N217S probably benign Het
Olfr132 A G 17: 38,130,889 L101P probably damaging Het
Olfr1362 T C 13: 21,611,261 K236R possibly damaging Het
Orm3 A G 4: 63,356,646 T64A probably benign Het
Phf20l1 T G 15: 66,639,991 W940G probably damaging Het
Phldb1 C T 9: 44,707,904 R844H probably damaging Het
Piezo2 T C 18: 63,102,084 D814G probably damaging Het
Pkd2 T C 5: 104,466,990 C233R probably damaging Het
Pth1r A T 9: 110,727,550 probably null Het
Pxdn T C 12: 29,982,727 L146S probably damaging Het
Rnf32 A G 5: 29,225,127 T315A probably benign Het
Rpl5 T C 5: 107,901,900 Y12H probably benign Het
Serpinh1 A T 7: 99,349,314 S36R probably damaging Het
Setx A T 2: 29,161,525 T2030S probably benign Het
Sf3a3 G A 4: 124,714,955 V21I probably benign Het
Sin3b T A 8: 72,725,582 H105Q probably damaging Het
Slitrk1 T C 14: 108,913,317 probably benign Het
Slx4 A T 16: 3,988,016 D557E possibly damaging Het
Sprr3 C T 3: 92,457,302 M78I probably benign Het
Ssmem1 A G 6: 30,519,421 E35G possibly damaging Het
Stag1 C T 9: 100,956,408 P1238S probably null Het
Stra6 C T 9: 58,152,615 probably benign Het
Tmem127 T C 2: 127,257,059 V171A probably damaging Het
Tmem150a A G 6: 72,358,759 probably null Het
Top2a C G 11: 99,015,060 probably null Het
Ttn T C 2: 76,814,427 probably null Het
Tusc3 G A 8: 39,063,267 G129R possibly damaging Het
Uspl1 A G 5: 149,209,705 Y422C probably damaging Het
Vmn2r88 A T 14: 51,414,140 T312S probably benign Het
Wdr78 A T 4: 103,059,934 I571K probably damaging Het
Zc3hav1l A T 6: 38,295,190 S215T probably damaging Het
Zfp947 T A 17: 22,146,184 T170S probably benign Het
Other mutations in Prkd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Prkd3 APN 17 78954523 missense probably benign 0.00
IGL01775:Prkd3 APN 17 79012760 missense probably damaging 1.00
IGL01875:Prkd3 APN 17 78957206 missense possibly damaging 0.95
IGL01892:Prkd3 APN 17 78972501 missense probably benign 0.13
FR4304:Prkd3 UTSW 17 78975820 splice site probably null
R0070:Prkd3 UTSW 17 78954510 missense probably damaging 1.00
R0374:Prkd3 UTSW 17 78957215 missense probably null 1.00
R0688:Prkd3 UTSW 17 78957233 missense probably damaging 0.99
R1112:Prkd3 UTSW 17 78966408 missense probably damaging 1.00
R1364:Prkd3 UTSW 17 78957258 missense probably damaging 1.00
R1382:Prkd3 UTSW 17 78957245 missense probably damaging 1.00
R1459:Prkd3 UTSW 17 78971367 missense probably damaging 1.00
R1522:Prkd3 UTSW 17 78952696 missense probably damaging 1.00
R1645:Prkd3 UTSW 17 78956520 critical splice donor site probably null
R2035:Prkd3 UTSW 17 78975373 critical splice donor site probably null
R2187:Prkd3 UTSW 17 78975554 missense probably benign
R2250:Prkd3 UTSW 17 78968078 missense probably benign 0.15
R2850:Prkd3 UTSW 17 78954596 missense possibly damaging 0.89
R3625:Prkd3 UTSW 17 78985304 missense probably damaging 1.00
R3773:Prkd3 UTSW 17 78959106 missense possibly damaging 0.52
R3973:Prkd3 UTSW 17 78959141 splice site probably benign
R4089:Prkd3 UTSW 17 78971388 missense possibly damaging 0.64
R4407:Prkd3 UTSW 17 78983558 missense probably damaging 1.00
R4453:Prkd3 UTSW 17 78983546 missense probably damaging 1.00
R4697:Prkd3 UTSW 17 78961171 missense probably benign 0.02
R4715:Prkd3 UTSW 17 78951937 missense possibly damaging 0.73
R4754:Prkd3 UTSW 17 78956614 missense probably damaging 1.00
R4955:Prkd3 UTSW 17 78952727 missense probably null 0.95
R5412:Prkd3 UTSW 17 78954711 missense possibly damaging 0.85
R6163:Prkd3 UTSW 17 78966355 missense possibly damaging 0.94
R6280:Prkd3 UTSW 17 78981931 missense probably damaging 0.97
R7074:Prkd3 UTSW 17 78974807 nonsense probably null
R7153:Prkd3 UTSW 17 78966355 missense probably benign 0.04
R7335:Prkd3 UTSW 17 78954566 missense probably damaging 0.99
R7492:Prkd3 UTSW 17 78962545 nonsense probably null
R7819:Prkd3 UTSW 17 78972501 missense probably benign 0.13
R7962:Prkd3 UTSW 17 79008262 start codon destroyed not run
X0063:Prkd3 UTSW 17 78956613 missense probably damaging 1.00
X0066:Prkd3 UTSW 17 78961182 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- ggcacacacatttaatcccag -3'
Posted On2013-08-06