Incidental Mutation 'R8338:Uhrf1bp1'
ID644771
Institutional Source Beutler Lab
Gene Symbol Uhrf1bp1
Ensembl Gene ENSMUSG00000039512
Gene NameUHRF1 (ICBP90) binding protein 1
Synonyms1110020K19Rik, F830021D11Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8338 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location27856490-27900040 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 27876695 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 26 (N26S)
Ref Sequence ENSEMBL: ENSMUSP00000110499 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114849]
Predicted Effect probably damaging
Transcript: ENSMUST00000114849
AA Change: N26S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000110499
Gene: ENSMUSG00000039512
AA Change: N26S

DomainStartEndE-ValueType
Pfam:Chorein_N 1 104 2.6e-18 PFAM
low complexity region 234 247 N/A INTRINSIC
low complexity region 297 306 N/A INTRINSIC
low complexity region 1128 1144 N/A INTRINSIC
low complexity region 1200 1216 N/A INTRINSIC
low complexity region 1322 1333 N/A INTRINSIC
low complexity region 1375 1386 N/A INTRINSIC
coiled coil region 1394 1424 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ache T C 5: 137,291,744 L445P probably damaging Het
Agrn G A 4: 156,168,561 T1773I probably benign Het
Arap3 A G 18: 37,973,630 S1387P probably damaging Het
Bcl11a G C 11: 24,164,578 K640N probably damaging Het
Bicd1 G A 6: 149,513,123 V445I probably benign Het
C2cd6 A C 1: 59,060,575 N402K probably benign Het
Celsr3 C T 9: 108,827,340 Q341* probably null Het
Cers1 A G 8: 70,331,122 E240G possibly damaging Het
Cfap157 G T 2: 32,778,006 T441N possibly damaging Het
Cfap44 G A 16: 44,419,335 probably null Het
Chd1 A G 17: 15,769,980 Y1598C probably damaging Het
Ckap2l T G 2: 129,285,019 Q413P probably damaging Het
Cobl T C 11: 12,253,696 E1002G probably benign Het
Cryge G A 1: 65,048,774 T156M unknown Het
Cubn A C 2: 13,430,847 F1099L probably benign Het
Cyp7b1 T C 3: 18,097,566 E161G probably benign Het
Dnah10 A G 5: 124,832,502 E4452G probably damaging Het
Dnah2 C T 11: 69,487,296 R1273Q probably damaging Het
Dnah3 T C 7: 120,071,881 E593G probably benign Het
Dnah9 C A 11: 65,841,241 probably null Het
Dnajc22 C A 15: 99,101,141 P69Q probably benign Het
Fam171a2 T A 11: 102,438,346 D529V probably benign Het
Fbxl17 T C 17: 63,356,758 I579V possibly damaging Het
Fry C T 5: 150,359,051 T347M probably damaging Het
Gm13272 A C 4: 88,780,127 D93A probably benign Het
Gm428 T A 4: 73,687,198 M282K possibly damaging Het
Gm4778 A G 3: 94,265,978 I94V possibly damaging Het
Grm4 A T 17: 27,435,003 F658I probably damaging Het
Hmcn1 G A 1: 150,738,734 T1307I probably benign Het
Igkv12-98 G A 6: 68,571,175 S96N probably benign Het
Il2ra A T 2: 11,683,074 T222S probably benign Het
Il5ra G T 6: 106,712,389 T414K probably benign Het
Isg15 T A 4: 156,199,631 I147F probably benign Het
Kif14 C A 1: 136,494,678 A902E probably damaging Het
Lcat G A 8: 105,940,087 R268C probably damaging Het
Lipa T C 19: 34,494,077 N366S probably benign Het
Lrp4 A G 2: 91,492,368 T1101A probably benign Het
Man1a T A 10: 53,925,547 probably null Het
Mib1 A G 18: 10,726,372 D23G probably benign Het
Morc2b A T 17: 33,136,413 M795K probably benign Het
Mycbp2 T A 14: 103,135,265 E4048D probably damaging Het
Myo7b A G 18: 31,971,355 S1447P probably damaging Het
Myt1 A T 2: 181,801,862 T536S possibly damaging Het
Nod1 A T 6: 54,943,971 L454Q probably damaging Het
Nrf1 T A 6: 30,140,248 W199R Het
Olfr1065 A T 2: 86,445,385 M199K probably benign Het
Olfr1490 T A 19: 13,654,852 M141K possibly damaging Het
Olfr301 T C 7: 86,412,494 I44T probably benign Het
Olfr460 T C 6: 40,571,976 F197L probably benign Het
Olfr60 T A 7: 140,345,393 M199L probably benign Het
Ostn G T 16: 27,324,535 A38S probably benign Het
Paxbp1 A T 16: 91,036,547 D266E probably damaging Het
Pcdhb14 G T 18: 37,449,122 G427V probably damaging Het
Pdzrn3 A T 6: 101,150,822 M961K probably benign Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 probably benign Het
Prdx5 T C 19: 6,907,264 D148G probably damaging Het
Ptprj A T 2: 90,471,137 I217N possibly damaging Het
Rccd1 A T 7: 80,320,870 L54Q possibly damaging Het
Rfx6 T A 10: 51,718,094 V370E probably damaging Het
Sdr16c6 C T 4: 4,076,620 C93Y probably damaging Het
Shroom1 A G 11: 53,463,280 D9G probably benign Het
Snrpe A G 1: 133,608,943 V33A probably benign Het
Spats2 T A 15: 99,178,459 D139E probably damaging Het
St18 A G 1: 6,809,292 E405G probably damaging Het
Strap A T 6: 137,741,978 E176V possibly damaging Het
Stxbp5l G T 16: 37,174,356 T729K probably damaging Het
Synj2bp G A 12: 81,504,552 Q97* probably null Het
Tbc1d32 T A 10: 56,028,077 Q1198L possibly damaging Het
Tmem98 T C 11: 80,821,309 S191P probably benign Het
Tnn C T 1: 160,118,483 G922R probably damaging Het
Treh A G 9: 44,684,511 N366S probably benign Het
Ttn T G 2: 76,919,792 S3638R probably benign Het
Uggt1 A G 1: 36,227,521 L124P probably damaging Het
V1rd19 A T 7: 24,003,249 K47* probably null Het
Wdhd1 T C 14: 47,268,663 M265V probably benign Het
Wsb1 T C 11: 79,246,277 D168G probably damaging Het
Other mutations in Uhrf1bp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00675:Uhrf1bp1 APN 17 27876917 splice site probably benign
IGL00786:Uhrf1bp1 APN 17 27879292 missense probably damaging 0.99
IGL01074:Uhrf1bp1 APN 17 27879291 missense possibly damaging 0.94
IGL01780:Uhrf1bp1 APN 17 27893500 missense probably damaging 1.00
IGL02668:Uhrf1bp1 APN 17 27886575 missense possibly damaging 0.53
IGL02686:Uhrf1bp1 APN 17 27894589 missense probably benign
IGL03240:Uhrf1bp1 APN 17 27893253 missense probably benign 0.37
hades UTSW 17 27894746 missense probably damaging 1.00
R0167:Uhrf1bp1 UTSW 17 27880202 missense possibly damaging 0.46
R0240:Uhrf1bp1 UTSW 17 27895870 splice site probably benign
R0332:Uhrf1bp1 UTSW 17 27893294 critical splice donor site probably null
R0668:Uhrf1bp1 UTSW 17 27895939 missense probably benign 0.16
R0726:Uhrf1bp1 UTSW 17 27885489 missense possibly damaging 0.50
R0964:Uhrf1bp1 UTSW 17 27887178 missense probably damaging 0.96
R1125:Uhrf1bp1 UTSW 17 27893449 missense probably damaging 1.00
R1139:Uhrf1bp1 UTSW 17 27890071 missense possibly damaging 0.87
R1164:Uhrf1bp1 UTSW 17 27895380 critical splice donor site probably null
R1192:Uhrf1bp1 UTSW 17 27890071 missense possibly damaging 0.87
R1277:Uhrf1bp1 UTSW 17 27890071 missense possibly damaging 0.87
R1279:Uhrf1bp1 UTSW 17 27890071 missense possibly damaging 0.87
R1340:Uhrf1bp1 UTSW 17 27894721 missense probably benign 0.00
R1341:Uhrf1bp1 UTSW 17 27877419 splice site probably benign
R1344:Uhrf1bp1 UTSW 17 27894577 missense probably benign 0.41
R1418:Uhrf1bp1 UTSW 17 27894577 missense probably benign 0.41
R1552:Uhrf1bp1 UTSW 17 27890071 missense possibly damaging 0.87
R1726:Uhrf1bp1 UTSW 17 27886251 splice site probably null
R1791:Uhrf1bp1 UTSW 17 27894746 missense probably damaging 1.00
R1796:Uhrf1bp1 UTSW 17 27890071 missense possibly damaging 0.87
R2858:Uhrf1bp1 UTSW 17 27885462 missense probably damaging 0.99
R3034:Uhrf1bp1 UTSW 17 27894746 missense probably damaging 1.00
R4111:Uhrf1bp1 UTSW 17 27886090 nonsense probably null
R4159:Uhrf1bp1 UTSW 17 27884087 missense probably damaging 1.00
R4160:Uhrf1bp1 UTSW 17 27884087 missense probably damaging 1.00
R4161:Uhrf1bp1 UTSW 17 27884087 missense probably damaging 1.00
R4431:Uhrf1bp1 UTSW 17 27885931 missense probably damaging 1.00
R4575:Uhrf1bp1 UTSW 17 27887503 missense probably benign 0.02
R4657:Uhrf1bp1 UTSW 17 27890105 missense probably benign 0.09
R4666:Uhrf1bp1 UTSW 17 27893503 missense possibly damaging 0.95
R4825:Uhrf1bp1 UTSW 17 27877394 missense probably damaging 0.98
R4872:Uhrf1bp1 UTSW 17 27890136 missense probably benign 0.10
R4956:Uhrf1bp1 UTSW 17 27889984 splice site probably null
R4976:Uhrf1bp1 UTSW 17 27884026 missense probably damaging 0.99
R4982:Uhrf1bp1 UTSW 17 27886606 missense probably benign 0.05
R5017:Uhrf1bp1 UTSW 17 27894739 nonsense probably null
R5033:Uhrf1bp1 UTSW 17 27886864 missense probably damaging 0.99
R5137:Uhrf1bp1 UTSW 17 27876990 splice site probably null
R5159:Uhrf1bp1 UTSW 17 27881556 missense probably damaging 0.98
R5177:Uhrf1bp1 UTSW 17 27885018 missense possibly damaging 0.94
R5196:Uhrf1bp1 UTSW 17 27856763 missense probably benign 0.09
R5214:Uhrf1bp1 UTSW 17 27887515 missense probably benign
R5352:Uhrf1bp1 UTSW 17 27887515 missense probably benign
R5354:Uhrf1bp1 UTSW 17 27887515 missense probably benign
R5425:Uhrf1bp1 UTSW 17 27887515 missense probably benign
R5601:Uhrf1bp1 UTSW 17 27884494 missense probably damaging 1.00
R6080:Uhrf1bp1 UTSW 17 27880297 missense probably benign
R6088:Uhrf1bp1 UTSW 17 27884605 critical splice donor site probably null
R6331:Uhrf1bp1 UTSW 17 27893201 missense probably benign 0.01
R6529:Uhrf1bp1 UTSW 17 27879776 missense possibly damaging 0.90
R6614:Uhrf1bp1 UTSW 17 27876925 missense probably benign 0.18
R6701:Uhrf1bp1 UTSW 17 27887357 nonsense probably null
R7082:Uhrf1bp1 UTSW 17 27890065 missense probably damaging 1.00
R7158:Uhrf1bp1 UTSW 17 27886433 nonsense probably null
RF005:Uhrf1bp1 UTSW 17 27885531 missense probably damaging 1.00
X0017:Uhrf1bp1 UTSW 17 27877341 missense probably benign 0.03
Z1176:Uhrf1bp1 UTSW 17 27876676 missense probably damaging 1.00
Z1176:Uhrf1bp1 UTSW 17 27886306 missense probably damaging 1.00
Z1177:Uhrf1bp1 UTSW 17 27884966 missense not run
Predicted Primers PCR Primer
(F):5'- CATCTGGCCTAGCTGCTTTG -3'
(R):5'- AAGTGAACAAGCCTGCTGG -3'

Sequencing Primer
(F):5'- CCTAGCTGCTTTGTTTTTAGGAGAC -3'
(R):5'- TGCAGTAGACCCTAGTGA -3'
Posted On2020-09-02