Incidental Mutation 'R8338:Myo7b'
ID 644775
Institutional Source Beutler Lab
Gene Symbol Myo7b
Ensembl Gene ENSMUSG00000024388
Gene Name myosin VIIB
Synonyms
MMRRC Submission 067730-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8338 (G1)
Quality Score 225.009
Status Not validated
Chromosome 18
Chromosomal Location 32092287-32169984 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 32104408 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 1447 (S1447P)
Ref Sequence ENSEMBL: ENSMUSP00000118046 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000134663]
AlphaFold Q99MZ6
Predicted Effect probably damaging
Transcript: ENSMUST00000134663
AA Change: S1447P

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000118046
Gene: ENSMUSG00000024388
AA Change: S1447P

DomainStartEndE-ValueType
MYSc 59 761 N/A SMART
IQ 762 784 1.07e-1 SMART
IQ 785 807 7.01e-6 SMART
IQ 831 853 4.93e-1 SMART
IQ 854 876 1.63e-1 SMART
MyTH4 989 1189 1.14e-71 SMART
B41 1190 1409 3.66e-16 SMART
SH3 1501 1563 3.25e-7 SMART
MyTH4 1641 1790 7.66e-55 SMART
B41 1792 2009 8.19e-28 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is found in brush border microvilli of epithelial cells in the intestines and kidneys. The encoded protein is involved in linking protocadherins to the actin cytoskeleton and is essential for proper microvilli function. This protein aids in the accumulation of intermicrovillar adhesion components such as harmonin and ANKS4B, and this accumulation is necessary for normal brush border action. [provided by RefSeq, Jan 2017]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ache T C 5: 137,290,006 (GRCm39) L445P probably damaging Het
Agrn G A 4: 156,253,018 (GRCm39) T1773I probably benign Het
Arap3 A G 18: 38,106,683 (GRCm39) S1387P probably damaging Het
Bcl11a G C 11: 24,114,578 (GRCm39) K640N probably damaging Het
Bicd1 G A 6: 149,414,621 (GRCm39) V445I probably benign Het
Bltp3a A G 17: 28,095,669 (GRCm39) N26S probably damaging Het
C2cd6 A C 1: 59,099,734 (GRCm39) N402K probably benign Het
Celsr3 C T 9: 108,704,539 (GRCm39) Q341* probably null Het
Cers1 A G 8: 70,783,772 (GRCm39) E240G possibly damaging Het
Cfap157 G T 2: 32,668,018 (GRCm39) T441N possibly damaging Het
Cfap44 G A 16: 44,239,698 (GRCm39) probably null Het
Chd1 A G 17: 15,990,242 (GRCm39) Y1598C probably damaging Het
Ckap2l T G 2: 129,126,939 (GRCm39) Q413P probably damaging Het
Cobl T C 11: 12,203,696 (GRCm39) E1002G probably benign Het
Cryge G A 1: 65,087,933 (GRCm39) T156M unknown Het
Cubn A C 2: 13,435,658 (GRCm39) F1099L probably benign Het
Cyp7b1 T C 3: 18,151,730 (GRCm39) E161G probably benign Het
Dnah10 A G 5: 124,909,566 (GRCm39) E4452G probably damaging Het
Dnah2 C T 11: 69,378,122 (GRCm39) R1273Q probably damaging Het
Dnah3 T C 7: 119,671,104 (GRCm39) E593G probably benign Het
Dnah9 C A 11: 65,732,067 (GRCm39) probably null Het
Dnajc22 C A 15: 98,999,022 (GRCm39) P69Q probably benign Het
Fam171a2 T A 11: 102,329,172 (GRCm39) D529V probably benign Het
Fbxl17 T C 17: 63,663,753 (GRCm39) I579V possibly damaging Het
Fry C T 5: 150,282,516 (GRCm39) T347M probably damaging Het
Gm13272 A C 4: 88,698,364 (GRCm39) D93A probably benign Het
Grm4 A T 17: 27,653,977 (GRCm39) F658I probably damaging Het
Hmcn1 G A 1: 150,614,485 (GRCm39) T1307I probably benign Het
Igkv12-98 G A 6: 68,548,159 (GRCm39) S96N probably benign Het
Il2ra A T 2: 11,687,885 (GRCm39) T222S probably benign Het
Il5ra G T 6: 106,689,350 (GRCm39) T414K probably benign Het
Isg15 T A 4: 156,284,088 (GRCm39) I147F probably benign Het
Kif14 C A 1: 136,422,416 (GRCm39) A902E probably damaging Het
Lcat G A 8: 106,666,719 (GRCm39) R268C probably damaging Het
Lipa T C 19: 34,471,477 (GRCm39) N366S probably benign Het
Lrp4 A G 2: 91,322,713 (GRCm39) T1101A probably benign Het
Man1a T A 10: 53,801,643 (GRCm39) probably null Het
Mib1 A G 18: 10,726,372 (GRCm39) D23G probably benign Het
Morc2b A T 17: 33,355,387 (GRCm39) M795K probably benign Het
Msantd5f1 T A 4: 73,605,435 (GRCm39) M282K possibly damaging Het
Mycbp2 T A 14: 103,372,701 (GRCm39) E4048D probably damaging Het
Myt1 A T 2: 181,443,655 (GRCm39) T536S possibly damaging Het
Nod1 A T 6: 54,920,956 (GRCm39) L454Q probably damaging Het
Nrf1 T A 6: 30,140,247 (GRCm39) W199R Het
Or10w1 T A 19: 13,632,216 (GRCm39) M141K possibly damaging Het
Or13a27 T A 7: 139,925,306 (GRCm39) M199L probably benign Het
Or14c44 T C 7: 86,061,702 (GRCm39) I44T probably benign Het
Or8k27 A T 2: 86,275,729 (GRCm39) M199K probably benign Het
Or9a4 T C 6: 40,548,910 (GRCm39) F197L probably benign Het
Ostn G T 16: 27,143,285 (GRCm39) A38S probably benign Het
Paxbp1 A T 16: 90,833,435 (GRCm39) D266E probably damaging Het
Pcdhb14 G T 18: 37,582,175 (GRCm39) G427V probably damaging Het
Pdzrn3 A T 6: 101,127,783 (GRCm39) M961K probably benign Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 (GRCm39) probably benign Het
Prdx5 T C 19: 6,884,632 (GRCm39) D148G probably damaging Het
Ptprj A T 2: 90,301,481 (GRCm39) I217N possibly damaging Het
Rccd1 A T 7: 79,970,618 (GRCm39) L54Q possibly damaging Het
Rfx6 T A 10: 51,594,190 (GRCm39) V370E probably damaging Het
Sdr16c6 C T 4: 4,076,620 (GRCm39) C93Y probably damaging Het
Shroom1 A G 11: 53,354,107 (GRCm39) D9G probably benign Het
Snrpe A G 1: 133,536,681 (GRCm39) V33A probably benign Het
Spats2 T A 15: 99,076,340 (GRCm39) D139E probably damaging Het
Spopfm1 A G 3: 94,173,285 (GRCm39) I94V possibly damaging Het
St18 A G 1: 6,879,516 (GRCm39) E405G probably damaging Het
Strap A T 6: 137,718,976 (GRCm39) E176V possibly damaging Het
Stxbp5l G T 16: 36,994,718 (GRCm39) T729K probably damaging Het
Synj2bp G A 12: 81,551,326 (GRCm39) Q97* probably null Het
Tbc1d32 T A 10: 55,904,173 (GRCm39) Q1198L possibly damaging Het
Tmem98 T C 11: 80,712,135 (GRCm39) S191P probably benign Het
Tnn C T 1: 159,946,053 (GRCm39) G922R probably damaging Het
Treh A G 9: 44,595,808 (GRCm39) N366S probably benign Het
Ttn T G 2: 76,750,136 (GRCm39) S3638R probably benign Het
Uggt1 A G 1: 36,266,602 (GRCm39) L124P probably damaging Het
V1rd19 A T 7: 23,702,674 (GRCm39) K47* probably null Het
Wdhd1 T C 14: 47,506,120 (GRCm39) M265V probably benign Het
Wsb1 T C 11: 79,137,103 (GRCm39) D168G probably damaging Het
Other mutations in Myo7b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00391:Myo7b APN 18 32,154,609 (GRCm39) utr 5 prime probably benign
IGL01799:Myo7b APN 18 32,095,823 (GRCm39) missense probably damaging 1.00
IGL01881:Myo7b APN 18 32,133,320 (GRCm39) splice site probably benign
IGL01883:Myo7b APN 18 32,131,204 (GRCm39) missense probably damaging 1.00
IGL01934:Myo7b APN 18 32,134,394 (GRCm39) critical splice donor site probably null
IGL01980:Myo7b APN 18 32,094,953 (GRCm39) missense possibly damaging 0.86
IGL02506:Myo7b APN 18 32,100,207 (GRCm39) missense probably damaging 1.00
IGL02704:Myo7b APN 18 32,100,014 (GRCm39) missense probably benign 0.13
IGL02929:Myo7b APN 18 32,127,978 (GRCm39) missense probably benign 0.19
IGL03149:Myo7b APN 18 32,147,355 (GRCm39) missense probably damaging 1.00
IGL03335:Myo7b APN 18 32,118,073 (GRCm39) missense possibly damaging 0.81
IGL03372:Myo7b APN 18 32,131,654 (GRCm39) missense probably damaging 1.00
IGL03385:Myo7b APN 18 32,122,630 (GRCm39) missense probably benign 0.00
PIT4131001:Myo7b UTSW 18 32,094,259 (GRCm39) missense probably benign 0.17
PIT4445001:Myo7b UTSW 18 32,095,405 (GRCm39) missense probably damaging 0.96
PIT4445001:Myo7b UTSW 18 32,092,519 (GRCm39) missense possibly damaging 0.80
R0034:Myo7b UTSW 18 32,093,913 (GRCm39) missense probably damaging 1.00
R0138:Myo7b UTSW 18 32,143,204 (GRCm39) missense probably damaging 1.00
R0149:Myo7b UTSW 18 32,147,262 (GRCm39) missense probably damaging 1.00
R0226:Myo7b UTSW 18 32,105,949 (GRCm39) missense probably benign 0.00
R0312:Myo7b UTSW 18 32,147,390 (GRCm39) missense possibly damaging 0.68
R0361:Myo7b UTSW 18 32,147,262 (GRCm39) missense probably damaging 1.00
R0506:Myo7b UTSW 18 32,097,439 (GRCm39) critical splice donor site probably null
R0524:Myo7b UTSW 18 32,146,477 (GRCm39) missense possibly damaging 0.91
R0645:Myo7b UTSW 18 32,127,962 (GRCm39) missense probably benign 0.10
R0724:Myo7b UTSW 18 32,138,602 (GRCm39) splice site probably benign
R0731:Myo7b UTSW 18 32,094,878 (GRCm39) splice site probably null
R0762:Myo7b UTSW 18 32,116,997 (GRCm39) missense probably benign 0.01
R0843:Myo7b UTSW 18 32,107,137 (GRCm39) missense possibly damaging 0.83
R0894:Myo7b UTSW 18 32,133,123 (GRCm39) missense probably damaging 1.00
R0966:Myo7b UTSW 18 32,131,816 (GRCm39) missense probably damaging 1.00
R1205:Myo7b UTSW 18 32,127,395 (GRCm39) missense probably damaging 1.00
R1387:Myo7b UTSW 18 32,116,805 (GRCm39) splice site probably benign
R1523:Myo7b UTSW 18 32,099,929 (GRCm39) missense probably damaging 1.00
R1544:Myo7b UTSW 18 32,127,962 (GRCm39) missense probably benign 0.10
R1623:Myo7b UTSW 18 32,133,104 (GRCm39) missense probably damaging 1.00
R1780:Myo7b UTSW 18 32,094,238 (GRCm39) missense probably damaging 1.00
R1785:Myo7b UTSW 18 32,127,950 (GRCm39) missense probably benign
R1786:Myo7b UTSW 18 32,127,950 (GRCm39) missense probably benign
R1796:Myo7b UTSW 18 32,119,728 (GRCm39) missense possibly damaging 0.93
R1907:Myo7b UTSW 18 32,110,052 (GRCm39) missense possibly damaging 0.89
R2027:Myo7b UTSW 18 32,118,013 (GRCm39) missense probably benign
R2102:Myo7b UTSW 18 32,133,031 (GRCm39) missense probably damaging 1.00
R2174:Myo7b UTSW 18 32,116,610 (GRCm39) missense probably damaging 1.00
R2272:Myo7b UTSW 18 32,110,096 (GRCm39) missense probably benign 0.41
R2323:Myo7b UTSW 18 32,104,398 (GRCm39) missense probably damaging 1.00
R2365:Myo7b UTSW 18 32,147,384 (GRCm39) missense probably damaging 0.98
R3078:Myo7b UTSW 18 32,100,237 (GRCm39) missense probably benign 0.04
R3522:Myo7b UTSW 18 32,143,132 (GRCm39) missense probably damaging 1.00
R3788:Myo7b UTSW 18 32,107,165 (GRCm39) missense possibly damaging 0.95
R3880:Myo7b UTSW 18 32,102,567 (GRCm39) missense probably damaging 0.96
R4334:Myo7b UTSW 18 32,110,040 (GRCm39) missense probably damaging 1.00
R4343:Myo7b UTSW 18 32,116,680 (GRCm39) missense probably damaging 1.00
R4497:Myo7b UTSW 18 32,147,282 (GRCm39) missense probably benign 0.06
R4498:Myo7b UTSW 18 32,147,282 (GRCm39) missense probably benign 0.06
R4551:Myo7b UTSW 18 32,118,161 (GRCm39) missense probably benign 0.01
R4593:Myo7b UTSW 18 32,146,428 (GRCm39) missense possibly damaging 0.77
R4616:Myo7b UTSW 18 32,136,540 (GRCm39) splice site probably null
R4646:Myo7b UTSW 18 32,127,422 (GRCm39) missense probably benign 0.25
R4648:Myo7b UTSW 18 32,100,178 (GRCm39) splice site probably null
R4737:Myo7b UTSW 18 32,131,655 (GRCm39) missense probably damaging 1.00
R4765:Myo7b UTSW 18 32,094,953 (GRCm39) missense probably benign 0.00
R4790:Myo7b UTSW 18 32,133,158 (GRCm39) splice site probably null
R4909:Myo7b UTSW 18 32,097,489 (GRCm39) missense probably benign 0.01
R5027:Myo7b UTSW 18 32,108,265 (GRCm39) missense probably benign 0.22
R5034:Myo7b UTSW 18 32,104,440 (GRCm39) missense probably damaging 1.00
R5112:Myo7b UTSW 18 32,116,640 (GRCm39) missense probably damaging 1.00
R5266:Myo7b UTSW 18 32,131,787 (GRCm39) missense probably damaging 1.00
R5267:Myo7b UTSW 18 32,131,787 (GRCm39) missense probably damaging 1.00
R5348:Myo7b UTSW 18 32,116,972 (GRCm39) missense probably damaging 0.96
R5457:Myo7b UTSW 18 32,104,503 (GRCm39) splice site probably null
R5540:Myo7b UTSW 18 32,140,143 (GRCm39) missense probably damaging 1.00
R5628:Myo7b UTSW 18 32,107,240 (GRCm39) missense probably benign
R5815:Myo7b UTSW 18 32,099,341 (GRCm39) missense probably damaging 1.00
R6062:Myo7b UTSW 18 32,101,043 (GRCm39) missense possibly damaging 0.94
R6137:Myo7b UTSW 18 32,133,027 (GRCm39) missense probably damaging 1.00
R6158:Myo7b UTSW 18 32,121,602 (GRCm39) missense probably benign 0.00
R6218:Myo7b UTSW 18 32,092,507 (GRCm39) missense probably benign 0.10
R6256:Myo7b UTSW 18 32,116,748 (GRCm39) missense probably damaging 1.00
R6257:Myo7b UTSW 18 32,146,468 (GRCm39) missense probably damaging 1.00
R6265:Myo7b UTSW 18 32,131,203 (GRCm39) missense probably damaging 1.00
R6302:Myo7b UTSW 18 32,127,439 (GRCm39) missense probably damaging 0.98
R6438:Myo7b UTSW 18 32,099,382 (GRCm39) missense probably damaging 1.00
R6654:Myo7b UTSW 18 32,123,322 (GRCm39) missense possibly damaging 0.46
R7030:Myo7b UTSW 18 32,104,626 (GRCm39) missense probably damaging 1.00
R7090:Myo7b UTSW 18 32,131,765 (GRCm39) missense probably damaging 1.00
R7210:Myo7b UTSW 18 32,140,155 (GRCm39) missense probably damaging 1.00
R7218:Myo7b UTSW 18 32,114,054 (GRCm39) missense probably benign 0.05
R7378:Myo7b UTSW 18 32,099,292 (GRCm39) missense probably damaging 1.00
R7458:Myo7b UTSW 18 32,121,604 (GRCm39) missense possibly damaging 0.89
R7517:Myo7b UTSW 18 32,146,320 (GRCm39) missense probably damaging 0.99
R7559:Myo7b UTSW 18 32,116,413 (GRCm39) missense probably benign 0.01
R7667:Myo7b UTSW 18 32,094,958 (GRCm39) missense probably benign
R7737:Myo7b UTSW 18 32,147,257 (GRCm39) nonsense probably null
R7942:Myo7b UTSW 18 32,146,422 (GRCm39) missense probably damaging 0.98
R8030:Myo7b UTSW 18 32,131,135 (GRCm39) missense probably damaging 0.96
R8114:Myo7b UTSW 18 32,098,677 (GRCm39) missense probably damaging 1.00
R8341:Myo7b UTSW 18 32,116,979 (GRCm39) missense probably benign 0.39
R8406:Myo7b UTSW 18 32,092,866 (GRCm39) missense probably damaging 1.00
R8464:Myo7b UTSW 18 32,095,757 (GRCm39) missense probably benign 0.00
R8517:Myo7b UTSW 18 32,100,244 (GRCm39) missense possibly damaging 0.87
R8537:Myo7b UTSW 18 32,110,142 (GRCm39) missense probably benign 0.08
R8546:Myo7b UTSW 18 32,123,201 (GRCm39) missense probably benign 0.19
R8721:Myo7b UTSW 18 32,140,064 (GRCm39) missense probably damaging 1.00
R8770:Myo7b UTSW 18 32,114,124 (GRCm39) missense probably benign 0.03
R8841:Myo7b UTSW 18 32,097,490 (GRCm39) missense probably benign 0.06
R8853:Myo7b UTSW 18 32,119,744 (GRCm39) missense possibly damaging 0.67
R8960:Myo7b UTSW 18 32,127,299 (GRCm39) splice site probably benign
R8984:Myo7b UTSW 18 32,099,402 (GRCm39) missense probably null 0.68
R9356:Myo7b UTSW 18 32,110,096 (GRCm39) missense probably damaging 1.00
R9357:Myo7b UTSW 18 32,093,129 (GRCm39) missense probably damaging 1.00
R9364:Myo7b UTSW 18 32,133,413 (GRCm39) missense probably benign 0.12
R9405:Myo7b UTSW 18 32,109,356 (GRCm39) missense probably benign 0.00
R9533:Myo7b UTSW 18 32,108,297 (GRCm39) missense probably benign 0.27
R9776:Myo7b UTSW 18 32,133,068 (GRCm39) missense probably benign 0.45
X0027:Myo7b UTSW 18 32,098,689 (GRCm39) missense probably damaging 1.00
Z1176:Myo7b UTSW 18 32,114,051 (GRCm39) missense possibly damaging 0.82
Z1177:Myo7b UTSW 18 32,118,109 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACCACATGCTCTTACCAGA -3'
(R):5'- AGTCACCACACTCTCTGGTAAGA -3'

Sequencing Primer
(F):5'- GAATTGTTTAAAGCGGCCCC -3'
(R):5'- CTCTGGTAAGAGCATGTGGTG -3'
Posted On 2020-09-02