Incidental Mutation 'R8338:Myo7b'
ID644775
Institutional Source Beutler Lab
Gene Symbol Myo7b
Ensembl Gene ENSMUSG00000024388
Gene Namemyosin VIIB
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8338 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location31959234-32036961 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 31971355 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 1447 (S1447P)
Ref Sequence ENSEMBL: ENSMUSP00000118046 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000134663]
Predicted Effect probably damaging
Transcript: ENSMUST00000134663
AA Change: S1447P

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000118046
Gene: ENSMUSG00000024388
AA Change: S1447P

DomainStartEndE-ValueType
MYSc 59 761 N/A SMART
IQ 762 784 1.07e-1 SMART
IQ 785 807 7.01e-6 SMART
IQ 831 853 4.93e-1 SMART
IQ 854 876 1.63e-1 SMART
MyTH4 989 1189 1.14e-71 SMART
B41 1190 1409 3.66e-16 SMART
SH3 1501 1563 3.25e-7 SMART
MyTH4 1641 1790 7.66e-55 SMART
B41 1792 2009 8.19e-28 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is found in brush border microvilli of epithelial cells in the intestines and kidneys. The encoded protein is involved in linking protocadherins to the actin cytoskeleton and is essential for proper microvilli function. This protein aids in the accumulation of intermicrovillar adhesion components such as harmonin and ANKS4B, and this accumulation is necessary for normal brush border action. [provided by RefSeq, Jan 2017]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ache T C 5: 137,291,744 L445P probably damaging Het
Agrn G A 4: 156,168,561 T1773I probably benign Het
Arap3 A G 18: 37,973,630 S1387P probably damaging Het
Bcl11a G C 11: 24,164,578 K640N probably damaging Het
Bicd1 G A 6: 149,513,123 V445I probably benign Het
C2cd6 A C 1: 59,060,575 N402K probably benign Het
Celsr3 C T 9: 108,827,340 Q341* probably null Het
Cers1 A G 8: 70,331,122 E240G possibly damaging Het
Cfap157 G T 2: 32,778,006 T441N possibly damaging Het
Cfap44 G A 16: 44,419,335 probably null Het
Chd1 A G 17: 15,769,980 Y1598C probably damaging Het
Ckap2l T G 2: 129,285,019 Q413P probably damaging Het
Cobl T C 11: 12,253,696 E1002G probably benign Het
Cryge G A 1: 65,048,774 T156M unknown Het
Cubn A C 2: 13,430,847 F1099L probably benign Het
Cyp7b1 T C 3: 18,097,566 E161G probably benign Het
Dnah10 A G 5: 124,832,502 E4452G probably damaging Het
Dnah2 C T 11: 69,487,296 R1273Q probably damaging Het
Dnah3 T C 7: 120,071,881 E593G probably benign Het
Dnah9 C A 11: 65,841,241 probably null Het
Dnajc22 C A 15: 99,101,141 P69Q probably benign Het
Fam171a2 T A 11: 102,438,346 D529V probably benign Het
Fbxl17 T C 17: 63,356,758 I579V possibly damaging Het
Fry C T 5: 150,359,051 T347M probably damaging Het
Gm13272 A C 4: 88,780,127 D93A probably benign Het
Gm428 T A 4: 73,687,198 M282K possibly damaging Het
Gm4778 A G 3: 94,265,978 I94V possibly damaging Het
Grm4 A T 17: 27,435,003 F658I probably damaging Het
Hmcn1 G A 1: 150,738,734 T1307I probably benign Het
Igkv12-98 G A 6: 68,571,175 S96N probably benign Het
Il2ra A T 2: 11,683,074 T222S probably benign Het
Il5ra G T 6: 106,712,389 T414K probably benign Het
Isg15 T A 4: 156,199,631 I147F probably benign Het
Kif14 C A 1: 136,494,678 A902E probably damaging Het
Lcat G A 8: 105,940,087 R268C probably damaging Het
Lipa T C 19: 34,494,077 N366S probably benign Het
Lrp4 A G 2: 91,492,368 T1101A probably benign Het
Man1a T A 10: 53,925,547 probably null Het
Mib1 A G 18: 10,726,372 D23G probably benign Het
Morc2b A T 17: 33,136,413 M795K probably benign Het
Mycbp2 T A 14: 103,135,265 E4048D probably damaging Het
Myt1 A T 2: 181,801,862 T536S possibly damaging Het
Nod1 A T 6: 54,943,971 L454Q probably damaging Het
Nrf1 T A 6: 30,140,248 W199R Het
Olfr1065 A T 2: 86,445,385 M199K probably benign Het
Olfr1490 T A 19: 13,654,852 M141K possibly damaging Het
Olfr301 T C 7: 86,412,494 I44T probably benign Het
Olfr460 T C 6: 40,571,976 F197L probably benign Het
Olfr60 T A 7: 140,345,393 M199L probably benign Het
Ostn G T 16: 27,324,535 A38S probably benign Het
Paxbp1 A T 16: 91,036,547 D266E probably damaging Het
Pcdhb14 G T 18: 37,449,122 G427V probably damaging Het
Pdzrn3 A T 6: 101,150,822 M961K probably benign Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 probably benign Het
Prdx5 T C 19: 6,907,264 D148G probably damaging Het
Ptprj A T 2: 90,471,137 I217N possibly damaging Het
Rccd1 A T 7: 80,320,870 L54Q possibly damaging Het
Rfx6 T A 10: 51,718,094 V370E probably damaging Het
Sdr16c6 C T 4: 4,076,620 C93Y probably damaging Het
Shroom1 A G 11: 53,463,280 D9G probably benign Het
Snrpe A G 1: 133,608,943 V33A probably benign Het
Spats2 T A 15: 99,178,459 D139E probably damaging Het
St18 A G 1: 6,809,292 E405G probably damaging Het
Strap A T 6: 137,741,978 E176V possibly damaging Het
Stxbp5l G T 16: 37,174,356 T729K probably damaging Het
Synj2bp G A 12: 81,504,552 Q97* probably null Het
Tbc1d32 T A 10: 56,028,077 Q1198L possibly damaging Het
Tmem98 T C 11: 80,821,309 S191P probably benign Het
Tnn C T 1: 160,118,483 G922R probably damaging Het
Treh A G 9: 44,684,511 N366S probably benign Het
Ttn T G 2: 76,919,792 S3638R probably benign Het
Uggt1 A G 1: 36,227,521 L124P probably damaging Het
Uhrf1bp1 A G 17: 27,876,695 N26S probably damaging Het
V1rd19 A T 7: 24,003,249 K47* probably null Het
Wdhd1 T C 14: 47,268,663 M265V probably benign Het
Wsb1 T C 11: 79,246,277 D168G probably damaging Het
Other mutations in Myo7b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00391:Myo7b APN 18 32021556 utr 5 prime probably benign
IGL01799:Myo7b APN 18 31962770 missense probably damaging 1.00
IGL01881:Myo7b APN 18 32000267 splice site probably benign
IGL01883:Myo7b APN 18 31998151 missense probably damaging 1.00
IGL01934:Myo7b APN 18 32001341 critical splice donor site probably null
IGL01980:Myo7b APN 18 31961900 missense possibly damaging 0.86
IGL02506:Myo7b APN 18 31967154 missense probably damaging 1.00
IGL02704:Myo7b APN 18 31966961 missense probably benign 0.13
IGL02929:Myo7b APN 18 31994925 missense probably benign 0.19
IGL03149:Myo7b APN 18 32014302 missense probably damaging 1.00
IGL03335:Myo7b APN 18 31985020 missense possibly damaging 0.81
IGL03372:Myo7b APN 18 31998601 missense probably damaging 1.00
IGL03385:Myo7b APN 18 31989577 missense probably benign 0.00
PIT4131001:Myo7b UTSW 18 31961206 missense probably benign 0.17
PIT4445001:Myo7b UTSW 18 31959466 missense possibly damaging 0.80
PIT4445001:Myo7b UTSW 18 31962352 missense probably damaging 0.96
R0034:Myo7b UTSW 18 31960860 missense probably damaging 1.00
R0138:Myo7b UTSW 18 32010151 missense probably damaging 1.00
R0149:Myo7b UTSW 18 32014209 missense probably damaging 1.00
R0226:Myo7b UTSW 18 31972896 missense probably benign 0.00
R0312:Myo7b UTSW 18 32014337 missense possibly damaging 0.68
R0361:Myo7b UTSW 18 32014209 missense probably damaging 1.00
R0506:Myo7b UTSW 18 31964386 critical splice donor site probably null
R0524:Myo7b UTSW 18 32013424 missense possibly damaging 0.91
R0645:Myo7b UTSW 18 31994909 missense probably benign 0.10
R0724:Myo7b UTSW 18 32005549 splice site probably benign
R0731:Myo7b UTSW 18 31961825 splice site probably null
R0762:Myo7b UTSW 18 31983944 missense probably benign 0.01
R0843:Myo7b UTSW 18 31974084 missense possibly damaging 0.83
R0894:Myo7b UTSW 18 32000070 missense probably damaging 1.00
R0966:Myo7b UTSW 18 31998763 missense probably damaging 1.00
R1205:Myo7b UTSW 18 31994342 missense probably damaging 1.00
R1387:Myo7b UTSW 18 31983752 splice site probably benign
R1523:Myo7b UTSW 18 31966876 missense probably damaging 1.00
R1544:Myo7b UTSW 18 31994909 missense probably benign 0.10
R1623:Myo7b UTSW 18 32000051 missense probably damaging 1.00
R1780:Myo7b UTSW 18 31961185 missense probably damaging 1.00
R1785:Myo7b UTSW 18 31994897 missense probably benign
R1786:Myo7b UTSW 18 31994897 missense probably benign
R1796:Myo7b UTSW 18 31986675 missense possibly damaging 0.93
R1907:Myo7b UTSW 18 31976999 missense possibly damaging 0.89
R2027:Myo7b UTSW 18 31984960 missense probably benign
R2102:Myo7b UTSW 18 31999978 missense probably damaging 1.00
R2174:Myo7b UTSW 18 31983557 missense probably damaging 1.00
R2272:Myo7b UTSW 18 31977043 missense probably benign 0.41
R2323:Myo7b UTSW 18 31971345 missense probably damaging 1.00
R2365:Myo7b UTSW 18 32014331 missense probably damaging 0.98
R3078:Myo7b UTSW 18 31967184 missense probably benign 0.04
R3522:Myo7b UTSW 18 32010079 missense probably damaging 1.00
R3788:Myo7b UTSW 18 31974112 missense possibly damaging 0.95
R3880:Myo7b UTSW 18 31969514 missense probably damaging 0.96
R4334:Myo7b UTSW 18 31976987 missense probably damaging 1.00
R4343:Myo7b UTSW 18 31983627 missense probably damaging 1.00
R4497:Myo7b UTSW 18 32014229 missense probably benign 0.06
R4498:Myo7b UTSW 18 32014229 missense probably benign 0.06
R4551:Myo7b UTSW 18 31985108 missense probably benign 0.01
R4593:Myo7b UTSW 18 32013375 missense possibly damaging 0.77
R4616:Myo7b UTSW 18 32003487 splice site probably null
R4646:Myo7b UTSW 18 31994369 missense probably benign 0.25
R4648:Myo7b UTSW 18 31967125 splice site probably null
R4737:Myo7b UTSW 18 31998602 missense probably damaging 1.00
R4765:Myo7b UTSW 18 31961900 missense probably benign 0.00
R4790:Myo7b UTSW 18 32000105 splice site probably null
R4909:Myo7b UTSW 18 31964436 missense probably benign 0.01
R5027:Myo7b UTSW 18 31975212 missense probably benign 0.22
R5034:Myo7b UTSW 18 31971387 missense probably damaging 1.00
R5112:Myo7b UTSW 18 31983587 missense probably damaging 1.00
R5266:Myo7b UTSW 18 31998734 missense probably damaging 1.00
R5267:Myo7b UTSW 18 31998734 missense probably damaging 1.00
R5348:Myo7b UTSW 18 31983919 missense probably damaging 0.96
R5457:Myo7b UTSW 18 31971450 splice site probably null
R5540:Myo7b UTSW 18 32007090 missense probably damaging 1.00
R5628:Myo7b UTSW 18 31974187 missense probably benign
R5815:Myo7b UTSW 18 31966288 missense probably damaging 1.00
R6062:Myo7b UTSW 18 31967990 missense possibly damaging 0.94
R6137:Myo7b UTSW 18 31999974 missense probably damaging 1.00
R6158:Myo7b UTSW 18 31988549 missense probably benign 0.00
R6218:Myo7b UTSW 18 31959454 missense probably benign 0.10
R6256:Myo7b UTSW 18 31983695 missense probably damaging 1.00
R6257:Myo7b UTSW 18 32013415 missense probably damaging 1.00
R6265:Myo7b UTSW 18 31998150 missense probably damaging 1.00
R6302:Myo7b UTSW 18 31994386 missense probably damaging 0.98
R6438:Myo7b UTSW 18 31966329 missense probably damaging 1.00
R6654:Myo7b UTSW 18 31990269 missense possibly damaging 0.46
R7030:Myo7b UTSW 18 31971573 missense probably damaging 1.00
R7090:Myo7b UTSW 18 31998712 missense probably damaging 1.00
R7210:Myo7b UTSW 18 32007102 missense probably damaging 1.00
R7218:Myo7b UTSW 18 31981001 missense probably benign 0.05
R7378:Myo7b UTSW 18 31966239 missense probably damaging 1.00
R7458:Myo7b UTSW 18 31988551 missense possibly damaging 0.89
R7517:Myo7b UTSW 18 32013267 missense probably damaging 0.99
R7559:Myo7b UTSW 18 31983360 missense probably benign 0.01
R7667:Myo7b UTSW 18 31961905 missense probably benign
R7737:Myo7b UTSW 18 32014204 nonsense probably null
R7942:Myo7b UTSW 18 32013369 missense probably damaging 0.98
R8030:Myo7b UTSW 18 31998082 missense probably damaging 0.96
R8114:Myo7b UTSW 18 31965624 missense probably damaging 1.00
R8341:Myo7b UTSW 18 31983926 missense probably benign 0.39
R8406:Myo7b UTSW 18 31959813 missense probably damaging 1.00
R8464:Myo7b UTSW 18 31962704 missense probably benign 0.00
R8517:Myo7b UTSW 18 31967191 missense possibly damaging 0.87
R8537:Myo7b UTSW 18 31977089 missense probably benign 0.08
R8546:Myo7b UTSW 18 31990148 missense probably benign 0.19
R8721:Myo7b UTSW 18 32007011 missense probably damaging 1.00
R8770:Myo7b UTSW 18 31981071 missense probably benign 0.03
R8841:Myo7b UTSW 18 31964437 missense probably benign 0.06
R8853:Myo7b UTSW 18 31986691 missense possibly damaging 0.67
X0027:Myo7b UTSW 18 31965636 missense probably damaging 1.00
Z1176:Myo7b UTSW 18 31980998 missense possibly damaging 0.82
Z1177:Myo7b UTSW 18 31985056 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACCACATGCTCTTACCAGA -3'
(R):5'- AGTCACCACACTCTCTGGTAAGA -3'

Sequencing Primer
(F):5'- GAATTGTTTAAAGCGGCCCC -3'
(R):5'- CTCTGGTAAGAGCATGTGGTG -3'
Posted On2020-09-02