Incidental Mutation 'R8338:Olfr1490'
ID644779
Institutional Source Beutler Lab
Gene Symbol Olfr1490
Ensembl Gene ENSMUSG00000061387
Gene Nameolfactory receptor 1490
SynonymsMOR266-6P, GA_x6K02T2RE5P-3987000-3987950
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock #R8338 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location13651091-13659545 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 13654852 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 141 (M141K)
Ref Sequence ENSEMBL: ENSMUSP00000151186 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080162] [ENSMUST00000213900]
Predicted Effect possibly damaging
Transcript: ENSMUST00000080162
AA Change: M136K

PolyPhen 2 Score 0.932 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000079057
Gene: ENSMUSG00000061387
AA Change: M136K

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 5.3e-48 PFAM
Pfam:7tm_1 41 290 2e-22 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000213900
AA Change: M141K

PolyPhen 2 Score 0.917 (Sensitivity: 0.81; Specificity: 0.94)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ache T C 5: 137,291,744 L445P probably damaging Het
Agrn G A 4: 156,168,561 T1773I probably benign Het
Arap3 A G 18: 37,973,630 S1387P probably damaging Het
Bcl11a G C 11: 24,164,578 K640N probably damaging Het
Bicd1 G A 6: 149,513,123 V445I probably benign Het
C2cd6 A C 1: 59,060,575 N402K probably benign Het
Celsr3 C T 9: 108,827,340 Q341* probably null Het
Cers1 A G 8: 70,331,122 E240G possibly damaging Het
Cfap157 G T 2: 32,778,006 T441N possibly damaging Het
Cfap44 G A 16: 44,419,335 probably null Het
Chd1 A G 17: 15,769,980 Y1598C probably damaging Het
Ckap2l T G 2: 129,285,019 Q413P probably damaging Het
Cobl T C 11: 12,253,696 E1002G probably benign Het
Cryge G A 1: 65,048,774 T156M unknown Het
Cubn A C 2: 13,430,847 F1099L probably benign Het
Cyp7b1 T C 3: 18,097,566 E161G probably benign Het
Dnah10 A G 5: 124,832,502 E4452G probably damaging Het
Dnah2 C T 11: 69,487,296 R1273Q probably damaging Het
Dnah3 T C 7: 120,071,881 E593G probably benign Het
Dnah9 C A 11: 65,841,241 probably null Het
Dnajc22 C A 15: 99,101,141 P69Q probably benign Het
Fam171a2 T A 11: 102,438,346 D529V probably benign Het
Fbxl17 T C 17: 63,356,758 I579V possibly damaging Het
Fry C T 5: 150,359,051 T347M probably damaging Het
Gm13272 A C 4: 88,780,127 D93A probably benign Het
Gm428 T A 4: 73,687,198 M282K possibly damaging Het
Gm4778 A G 3: 94,265,978 I94V possibly damaging Het
Grm4 A T 17: 27,435,003 F658I probably damaging Het
Hmcn1 G A 1: 150,738,734 T1307I probably benign Het
Igkv12-98 G A 6: 68,571,175 S96N probably benign Het
Il2ra A T 2: 11,683,074 T222S probably benign Het
Il5ra G T 6: 106,712,389 T414K probably benign Het
Isg15 T A 4: 156,199,631 I147F probably benign Het
Kif14 C A 1: 136,494,678 A902E probably damaging Het
Lcat G A 8: 105,940,087 R268C probably damaging Het
Lipa T C 19: 34,494,077 N366S probably benign Het
Lrp4 A G 2: 91,492,368 T1101A probably benign Het
Man1a T A 10: 53,925,547 probably null Het
Mib1 A G 18: 10,726,372 D23G probably benign Het
Morc2b A T 17: 33,136,413 M795K probably benign Het
Mycbp2 T A 14: 103,135,265 E4048D probably damaging Het
Myo7b A G 18: 31,971,355 S1447P probably damaging Het
Myt1 A T 2: 181,801,862 T536S possibly damaging Het
Nod1 A T 6: 54,943,971 L454Q probably damaging Het
Nrf1 T A 6: 30,140,248 W199R Het
Olfr1065 A T 2: 86,445,385 M199K probably benign Het
Olfr301 T C 7: 86,412,494 I44T probably benign Het
Olfr460 T C 6: 40,571,976 F197L probably benign Het
Olfr60 T A 7: 140,345,393 M199L probably benign Het
Ostn G T 16: 27,324,535 A38S probably benign Het
Paxbp1 A T 16: 91,036,547 D266E probably damaging Het
Pcdhb14 G T 18: 37,449,122 G427V probably damaging Het
Pdzrn3 A T 6: 101,150,822 M961K probably benign Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 probably benign Het
Prdx5 T C 19: 6,907,264 D148G probably damaging Het
Ptprj A T 2: 90,471,137 I217N possibly damaging Het
Rccd1 A T 7: 80,320,870 L54Q possibly damaging Het
Rfx6 T A 10: 51,718,094 V370E probably damaging Het
Sdr16c6 C T 4: 4,076,620 C93Y probably damaging Het
Shroom1 A G 11: 53,463,280 D9G probably benign Het
Snrpe A G 1: 133,608,943 V33A probably benign Het
Spats2 T A 15: 99,178,459 D139E probably damaging Het
St18 A G 1: 6,809,292 E405G probably damaging Het
Strap A T 6: 137,741,978 E176V possibly damaging Het
Stxbp5l G T 16: 37,174,356 T729K probably damaging Het
Synj2bp G A 12: 81,504,552 Q97* probably null Het
Tbc1d32 T A 10: 56,028,077 Q1198L possibly damaging Het
Tmem98 T C 11: 80,821,309 S191P probably benign Het
Tnn C T 1: 160,118,483 G922R probably damaging Het
Treh A G 9: 44,684,511 N366S probably benign Het
Ttn T G 2: 76,919,792 S3638R probably benign Het
Uggt1 A G 1: 36,227,521 L124P probably damaging Het
Uhrf1bp1 A G 17: 27,876,695 N26S probably damaging Het
V1rd19 A T 7: 24,003,249 K47* probably null Het
Wdhd1 T C 14: 47,268,663 M265V probably benign Het
Wsb1 T C 11: 79,246,277 D168G probably damaging Het
Other mutations in Olfr1490
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01324:Olfr1490 APN 19 13654933 missense probably damaging 0.96
IGL01335:Olfr1490 APN 19 13655176 missense probably damaging 1.00
IGL01561:Olfr1490 APN 19 13654905 missense probably benign
IGL01644:Olfr1490 APN 19 13655404 utr 3 prime probably benign
IGL02257:Olfr1490 APN 19 13655265 missense probably benign
IGL02282:Olfr1490 APN 19 13655258 missense probably damaging 1.00
IGL02355:Olfr1490 APN 19 13655233 missense probably benign 0.02
IGL02362:Olfr1490 APN 19 13655233 missense probably benign 0.02
IGL02639:Olfr1490 APN 19 13654596 missense possibly damaging 0.73
R0078:Olfr1490 UTSW 19 13654815 missense probably benign 0.00
R0278:Olfr1490 UTSW 19 13654764 missense probably damaging 1.00
R0278:Olfr1490 UTSW 19 13654765 missense probably damaging 1.00
R0506:Olfr1490 UTSW 19 13654897 missense possibly damaging 0.62
R0927:Olfr1490 UTSW 19 13654452 missense probably damaging 0.99
R1087:Olfr1490 UTSW 19 13655012 nonsense probably null
R1762:Olfr1490 UTSW 19 13654504 missense probably benign
R2901:Olfr1490 UTSW 19 13654945 missense probably damaging 1.00
R2907:Olfr1490 UTSW 19 13655247 missense possibly damaging 0.84
R3625:Olfr1490 UTSW 19 13654982 nonsense probably null
R3838:Olfr1490 UTSW 19 13654957 missense probably benign 0.00
R4745:Olfr1490 UTSW 19 13655386 missense probably benign
R4804:Olfr1490 UTSW 19 13654518 missense probably benign
R5026:Olfr1490 UTSW 19 13654932 missense probably benign 0.03
R5314:Olfr1490 UTSW 19 13655266 missense probably benign 0.08
R6052:Olfr1490 UTSW 19 13654507 missense possibly damaging 0.95
R6235:Olfr1490 UTSW 19 13654781 nonsense probably null
R7405:Olfr1490 UTSW 19 13654882 missense probably benign 0.14
R7557:Olfr1490 UTSW 19 13655026 missense possibly damaging 0.71
R8038:Olfr1490 UTSW 19 13655355 missense possibly damaging 0.91
R8366:Olfr1490 UTSW 19 13654539 missense probably damaging 1.00
Z1176:Olfr1490 UTSW 19 13654463 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCCTCTCAGGGATAGAGCTATG -3'
(R):5'- CATTAGCACAGAGAGCTCATGG -3'

Sequencing Primer
(F):5'- CTCTCAGGGATAGAGCTATGTTACAC -3'
(R):5'- CTCATGGATATGACTTGTGGCAC -3'
Posted On2020-09-02