Incidental Mutation 'R8339:Il12a'
ID 644790
Institutional Source Beutler Lab
Gene Symbol Il12a
Ensembl Gene ENSMUSG00000027776
Gene Name interleukin 12a
Synonyms IL-12p35, p35
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8339 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 68690644-68698547 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 68692105 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Stop codon at position 33 (C33*)
Ref Sequence ENSEMBL: ENSMUSP00000103446 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029345] [ENSMUST00000107816]
AlphaFold P43431
Predicted Effect probably null
Transcript: ENSMUST00000029345
AA Change: C54*
SMART Domains Protein: ENSMUSP00000029345
Gene: ENSMUSG00000027776
AA Change: C54*

DomainStartEndE-ValueType
low complexity region 1 26 N/A INTRINSIC
Pfam:IL12 27 236 2.5e-106 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000107816
AA Change: C33*
SMART Domains Protein: ENSMUSP00000103446
Gene: ENSMUSG00000027776
AA Change: C33*

DomainStartEndE-ValueType
Pfam:IL12 1 215 6.8e-128 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of a cytokine that acts on T and natural killer cells, and has a broad array of biological activities. The cytokine is a disulfide-linked heterodimer composed of the 35-kD subunit encoded by this gene, and a 40-kD subunit that is a member of the cytokine receptor family. This cytokine is required for the T-cell-independent induction of interferon (IFN)-gamma, and is important for the differentiation of both Th1 and Th2 cells. The responses of lymphocytes to this cytokine are mediated by the activator of transcription protein STAT4. Nitric oxide synthase 2A (NOS2A/NOS2) is found to be required for the signaling process of this cytokine in innate immunity. [provided by RefSeq, Jul 2008]
PHENOTYPE: Null homozygotes have decreased NK cell responses, altered effector T cell differentiation, and increased susceptibility to parasitic infections. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 A G 1: 71,285,672 F1549S probably damaging Het
Ablim1 T C 19: 57,043,849 E710G probably benign Het
Adam34 A T 8: 43,650,603 H668Q probably benign Het
Asphd2 A T 5: 112,391,635 Y111N possibly damaging Het
Camsap1 A G 2: 25,982,805 I45T possibly damaging Het
Ccdc88c A T 12: 100,941,140 L984* probably null Het
Ccr1 T G 9: 123,963,726 N256H probably damaging Het
Cep295 A T 9: 15,325,550 D254E Het
Cmya5 G T 13: 93,091,634 Y2315* probably null Het
Cspp1 G T 1: 10,113,667 R839I probably damaging Het
Dbn1 A T 13: 55,482,169 D153E probably benign Het
Dnah7a G T 1: 53,685,019 L96I probably benign Het
G6pc A G 11: 101,376,488 T255A possibly damaging Het
Gm4788 T A 1: 139,732,419 E656V probably damaging Het
Heatr5a AGCACACTGCAGGAAGCTCACACAGCACAGCATACCTTCAGGAGTGCACACTGCAGGAAGCTCACACAGCACAGCATACCTTCAGGAGAGCACACTGCAGGAAGCTCA AGCACACTGCAGGAAGCTCACACAGCACAGCATACCTTCAGGAGAGCACACTGCAGGAAGCTCA 12: 51,887,919 probably benign Het
Iqce T C 5: 140,674,338 E555G probably damaging Het
Itpr2 T C 6: 146,312,898 M1484V probably benign Het
Klc2 A G 19: 5,109,534 S518P probably benign Het
Ogfr GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG 2: 180,595,266 probably benign Het
Olfr1015 C A 2: 85,785,532 T7N probably damaging Het
Olfr1535 A T 13: 21,555,826 N65K probably damaging Het
Olfr911-ps1 T C 9: 38,524,421 S230P probably damaging Het
Otogl T A 10: 107,789,535 I1516F probably damaging Het
Otogl G T 10: 107,789,536 S1515R probably benign Het
Pacs1 A T 19: 5,142,623 V627E probably damaging Het
Ptprb A C 10: 116,283,451 R163S probably benign Het
Ralgps2 G T 1: 156,821,438 P432Q probably null Het
Rgl3 T C 9: 21,987,529 T205A probably benign Het
Rock2 G T 12: 16,974,860 W1213L probably damaging Het
Satb1 T A 17: 51,782,949 H290L probably damaging Het
Scn1a T C 2: 66,286,029 Y422C probably damaging Het
Sgcg T A 14: 61,232,517 M132L probably benign Het
Shank1 A G 7: 44,326,165 S478G unknown Het
Slc18a1 A T 8: 69,065,621 M247K possibly damaging Het
Slc37a4 A G 9: 44,402,427 I417V probably benign Het
Slc9b2 A G 3: 135,324,602 M227V possibly damaging Het
Tcf20 C A 15: 82,852,676 V1525L probably benign Het
Tril G A 6: 53,817,933 T768I possibly damaging Het
Xxylt1 T C 16: 31,081,040 H99R possibly damaging Het
Zfp653 T C 9: 22,057,917 E351G probably damaging Het
Other mutations in Il12a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01734:Il12a APN 3 68691555 missense possibly damaging 0.96
IGL01820:Il12a APN 3 68692162 splice site probably benign
IGL01989:Il12a APN 3 68691576 splice site probably benign
bakers_dozen UTSW 3 68697987 frame shift probably null
R0388:Il12a UTSW 3 68695187 splice site probably null
R0646:Il12a UTSW 3 68697890 splice site probably benign
R1083:Il12a UTSW 3 68695333 missense probably damaging 1.00
R1588:Il12a UTSW 3 68695563 missense probably benign 0.04
R2240:Il12a UTSW 3 68694184 nonsense probably null
R2909:Il12a UTSW 3 68697987 frame shift probably null
R2925:Il12a UTSW 3 68697987 frame shift probably null
R3696:Il12a UTSW 3 68697987 frame shift probably null
R3697:Il12a UTSW 3 68697987 frame shift probably null
R3698:Il12a UTSW 3 68697987 frame shift probably null
R4332:Il12a UTSW 3 68695261 intron probably benign
R5809:Il12a UTSW 3 68695262 intron probably benign
R6279:Il12a UTSW 3 68697979 missense probably damaging 0.96
R6305:Il12a UTSW 3 68694178 missense possibly damaging 0.80
R6847:Il12a UTSW 3 68695566 missense probably damaging 1.00
R7751:Il12a UTSW 3 68697902 missense probably damaging 1.00
R8188:Il12a UTSW 3 68691539 missense unknown
R9145:Il12a UTSW 3 68691542 missense unknown
RF003:Il12a UTSW 3 68695229 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGGTCTTGCTTCATCTGTCAGC -3'
(R):5'- AGTCTTGAAACCCTCTACGGTTC -3'

Sequencing Primer
(F):5'- CCCGGGGAAGGGCTTAAATTATG -3'
(R):5'- GGTTCCTGCCAGATACCATAAACTTC -3'
Posted On 2020-09-02