Incidental Mutation 'R8339:Sgcg'
ID644815
Institutional Source Beutler Lab
Gene Symbol Sgcg
Ensembl Gene ENSMUSG00000035296
Gene Namesarcoglycan, gamma (dystrophin-associated glycoprotein)
Synonymsgamma-SG, 5430420E18Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.197) question?
Stock #R8339 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location61219115-61258490 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 61232517 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 132 (M132L)
Ref Sequence ENSEMBL: ENSMUSP00000077106 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077954] [ENSMUST00000089394] [ENSMUST00000121148]
Predicted Effect probably benign
Transcript: ENSMUST00000077954
AA Change: M132L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000077106
Gene: ENSMUSG00000035296
AA Change: M132L

DomainStartEndE-ValueType
Pfam:Sarcoglycan_1 25 280 1.2e-81 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000089394
SMART Domains Protein: ENSMUSP00000086816
Gene: ENSMUSG00000048279

DomainStartEndE-ValueType
SCOP:d1lm8b_ 8 66 3e-3 SMART
Blast:UBQ 9 81 3e-31 BLAST
Blast:HATPase_c 116 211 2e-10 BLAST
low complexity region 608 623 N/A INTRINSIC
low complexity region 664 673 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121148
AA Change: M132L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000112576
Gene: ENSMUSG00000035296
AA Change: M132L

DomainStartEndE-ValueType
Pfam:Sarcoglycan_1 23 284 1.1e-106 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes gamma-sarcoglycan, one of several sarcolemmal transmembrane glycoproteins that interact with dystrophin. The dystrophin-glycoprotein complex (DGC) spans the sarcolemma and is comprised of dystrophin, syntrophin, alpha- and beta-dystroglycans and sarcoglycans. The DGC provides a structural link between the subsarcolemmal cytoskeleton and the extracellular matrix of muscle cells. Defects in the encoded protein can lead to early onset autosomal recessive muscular dystrophy, in particular limb-girdle muscular dystrophy, type 2C (LGMD2C). [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display abnormalities in muscles and heart similar to muscular dystrophy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 A G 1: 71,285,672 F1549S probably damaging Het
Ablim1 T C 19: 57,043,849 E710G probably benign Het
Adam34 A T 8: 43,650,603 H668Q probably benign Het
Asphd2 A T 5: 112,391,635 Y111N possibly damaging Het
Camsap1 A G 2: 25,982,805 I45T possibly damaging Het
Ccdc88c A T 12: 100,941,140 L984* probably null Het
Ccr1 T G 9: 123,963,726 N256H probably damaging Het
Cep295 A T 9: 15,325,550 D254E Het
Cmya5 G T 13: 93,091,634 Y2315* probably null Het
Cspp1 G T 1: 10,113,667 R839I probably damaging Het
Dbn1 A T 13: 55,482,169 D153E probably benign Het
Dnah7a G T 1: 53,685,019 L96I probably benign Het
G6pc A G 11: 101,376,488 T255A possibly damaging Het
Gm4788 T A 1: 139,732,419 E656V probably damaging Het
Heatr5a AGCACACTGCAGGAAGCTCACACAGCACAGCATACCTTCAGGAGTGCACACTGCAGGAAGCTCACACAGCACAGCATACCTTCAGGAGAGCACACTGCAGGAAGCTCA AGCACACTGCAGGAAGCTCACACAGCACAGCATACCTTCAGGAGAGCACACTGCAGGAAGCTCA 12: 51,887,919 probably benign Het
Il12a T A 3: 68,692,105 C33* probably null Het
Iqce T C 5: 140,674,338 E555G probably damaging Het
Itpr2 T C 6: 146,312,898 M1484V probably benign Het
Klc2 A G 19: 5,109,534 S518P probably benign Het
Ogfr GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG 2: 180,595,266 probably benign Het
Olfr1015 C A 2: 85,785,532 T7N probably damaging Het
Olfr1535 A T 13: 21,555,826 N65K probably damaging Het
Olfr911-ps1 T C 9: 38,524,421 S230P probably damaging Het
Otogl T A 10: 107,789,535 I1516F probably damaging Het
Otogl G T 10: 107,789,536 S1515R probably benign Het
Pacs1 A T 19: 5,142,623 V627E probably damaging Het
Ptprb A C 10: 116,283,451 R163S probably benign Het
Ralgps2 G T 1: 156,821,438 P432Q probably null Het
Rgl3 T C 9: 21,987,529 T205A probably benign Het
Rock2 G T 12: 16,974,860 W1213L probably damaging Het
Satb1 T A 17: 51,782,949 H290L probably damaging Het
Scn1a T C 2: 66,286,029 Y422C probably damaging Het
Shank1 A G 7: 44,326,165 S478G unknown Het
Slc18a1 A T 8: 69,065,621 M247K possibly damaging Het
Slc37a4 A G 9: 44,402,427 I417V probably benign Het
Slc9b2 A G 3: 135,324,602 M227V possibly damaging Het
Tcf20 C A 15: 82,852,676 V1525L probably benign Het
Tril G A 6: 53,817,933 T768I possibly damaging Het
Xxylt1 T C 16: 31,081,040 H99R possibly damaging Het
Zfp653 T C 9: 22,057,917 E351G probably damaging Het
Other mutations in Sgcg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Sgcg APN 14 61240347 nonsense probably null
IGL00159:Sgcg APN 14 61232475 missense probably benign 0.00
R0466:Sgcg UTSW 14 61221686 missense probably damaging 1.00
R1236:Sgcg UTSW 14 61245770 missense probably damaging 0.99
R1870:Sgcg UTSW 14 61240447 splice site probably benign
R1879:Sgcg UTSW 14 61236897 critical splice acceptor site probably null
R1933:Sgcg UTSW 14 61232412 missense possibly damaging 0.77
R2090:Sgcg UTSW 14 61245764 missense probably damaging 0.99
R2937:Sgcg UTSW 14 61229625 missense probably damaging 1.00
R2938:Sgcg UTSW 14 61229625 missense probably damaging 1.00
R3508:Sgcg UTSW 14 61221746 missense probably benign
R5345:Sgcg UTSW 14 61245769 missense probably damaging 0.99
R5464:Sgcg UTSW 14 61236855 missense possibly damaging 0.65
R5582:Sgcg UTSW 14 61225305 missense probably damaging 1.00
R7259:Sgcg UTSW 14 61225217 missense probably benign 0.30
R7335:Sgcg UTSW 14 61240367 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACTGCCTTTCCTTAGCAGAGTG -3'
(R):5'- GAGCAAATTGTGAGCTTTGATTCC -3'

Sequencing Primer
(F):5'- CAGAGTGCAGAGCAGAGCTG -3'
(R):5'- AATCTGTCACCAAAGCCTTTTG -3'
Posted On2020-09-02