Incidental Mutation 'R8339:Pacs1'
ID 644820
Institutional Source Beutler Lab
Gene Symbol Pacs1
Ensembl Gene ENSMUSG00000024855
Gene Name phosphofurin acidic cluster sorting protein 1
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8339 (G1)
Quality Score 225.009
Status Not validated
Chromosome 19
Chromosomal Location 5133688-5273119 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 5142623 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 627 (V627E)
Ref Sequence ENSEMBL: ENSMUSP00000025786 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025786]
AlphaFold Q8K212
Predicted Effect probably damaging
Transcript: ENSMUST00000025786
AA Change: V627E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025786
Gene: ENSMUSG00000024855
AA Change: V627E

DomainStartEndE-ValueType
low complexity region 5 24 N/A INTRINSIC
low complexity region 27 46 N/A INTRINSIC
low complexity region 51 97 N/A INTRINSIC
low complexity region 276 290 N/A INTRINSIC
low complexity region 306 320 N/A INTRINSIC
low complexity region 359 372 N/A INTRINSIC
Pfam:Pacs-1 546 958 2e-193 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with a putative role in the localization of trans-Golgi network (TGN) membrane proteins. Mouse and rat homologs have been identified and studies of the homologous rat protein indicate a role in directing TGN localization of furin by binding to the protease's phosphorylated cytosolic domain. In addition, the human protein plays a role in HIV-1 Nef-mediated downregulation of cell surface MHC-I molecules to the TGN, thereby enabling HIV-1 to escape immune surveillance. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 A G 1: 71,285,672 F1549S probably damaging Het
Ablim1 T C 19: 57,043,849 E710G probably benign Het
Adam34 A T 8: 43,650,603 H668Q probably benign Het
Asphd2 A T 5: 112,391,635 Y111N possibly damaging Het
Camsap1 A G 2: 25,982,805 I45T possibly damaging Het
Ccdc88c A T 12: 100,941,140 L984* probably null Het
Ccr1 T G 9: 123,963,726 N256H probably damaging Het
Cep295 A T 9: 15,325,550 D254E Het
Cmya5 G T 13: 93,091,634 Y2315* probably null Het
Cspp1 G T 1: 10,113,667 R839I probably damaging Het
Dbn1 A T 13: 55,482,169 D153E probably benign Het
Dnah7a G T 1: 53,685,019 L96I probably benign Het
G6pc A G 11: 101,376,488 T255A possibly damaging Het
Gm4788 T A 1: 139,732,419 E656V probably damaging Het
Heatr5a AGCACACTGCAGGAAGCTCACACAGCACAGCATACCTTCAGGAGTGCACACTGCAGGAAGCTCACACAGCACAGCATACCTTCAGGAGAGCACACTGCAGGAAGCTCA AGCACACTGCAGGAAGCTCACACAGCACAGCATACCTTCAGGAGAGCACACTGCAGGAAGCTCA 12: 51,887,919 probably benign Het
Il12a T A 3: 68,692,105 C33* probably null Het
Iqce T C 5: 140,674,338 E555G probably damaging Het
Itpr2 T C 6: 146,312,898 M1484V probably benign Het
Klc2 A G 19: 5,109,534 S518P probably benign Het
Ogfr GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG 2: 180,595,266 probably benign Het
Olfr1015 C A 2: 85,785,532 T7N probably damaging Het
Olfr1535 A T 13: 21,555,826 N65K probably damaging Het
Olfr911-ps1 T C 9: 38,524,421 S230P probably damaging Het
Otogl T A 10: 107,789,535 I1516F probably damaging Het
Otogl G T 10: 107,789,536 S1515R probably benign Het
Ptprb A C 10: 116,283,451 R163S probably benign Het
Ralgps2 G T 1: 156,821,438 P432Q probably null Het
Rgl3 T C 9: 21,987,529 T205A probably benign Het
Rock2 G T 12: 16,974,860 W1213L probably damaging Het
Satb1 T A 17: 51,782,949 H290L probably damaging Het
Scn1a T C 2: 66,286,029 Y422C probably damaging Het
Sgcg T A 14: 61,232,517 M132L probably benign Het
Shank1 A G 7: 44,326,165 S478G unknown Het
Slc18a1 A T 8: 69,065,621 M247K possibly damaging Het
Slc37a4 A G 9: 44,402,427 I417V probably benign Het
Slc9b2 A G 3: 135,324,602 M227V possibly damaging Het
Tcf20 C A 15: 82,852,676 V1525L probably benign Het
Tril G A 6: 53,817,933 T768I possibly damaging Het
Xxylt1 T C 16: 31,081,040 H99R possibly damaging Het
Zfp653 T C 9: 22,057,917 E351G probably damaging Het
Other mutations in Pacs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00585:Pacs1 APN 19 5153698 missense probably damaging 0.98
IGL01335:Pacs1 APN 19 5142632 missense probably damaging 1.00
IGL01717:Pacs1 APN 19 5167972 missense probably damaging 1.00
IGL02453:Pacs1 APN 19 5135005 missense probably damaging 1.00
IGL02887:Pacs1 APN 19 5135110 splice site probably benign
Batavian UTSW 19 5156413 missense possibly damaging 0.71
chicory UTSW 19 5139297 missense probably benign 0.33
endive UTSW 19 5272583 nonsense probably null
Escarole UTSW 19 5156356 critical splice donor site probably null
frisee UTSW 19 5136791 missense probably damaging 1.00
R0240:Pacs1 UTSW 19 5156374 missense possibly damaging 0.69
R0240:Pacs1 UTSW 19 5156374 missense possibly damaging 0.69
R0316:Pacs1 UTSW 19 5135121 splice site silent
R0369:Pacs1 UTSW 19 5141698 missense probably damaging 1.00
R0443:Pacs1 UTSW 19 5272583 nonsense probably null
R0973:Pacs1 UTSW 19 5143829 missense probably damaging 1.00
R0973:Pacs1 UTSW 19 5143829 missense probably damaging 1.00
R0974:Pacs1 UTSW 19 5143829 missense probably damaging 1.00
R1202:Pacs1 UTSW 19 5135237 missense probably damaging 1.00
R1672:Pacs1 UTSW 19 5152309 missense probably benign 0.00
R1689:Pacs1 UTSW 19 5272615 unclassified probably benign
R1842:Pacs1 UTSW 19 5155884 missense probably damaging 0.96
R1847:Pacs1 UTSW 19 5153714 missense probably damaging 0.99
R3884:Pacs1 UTSW 19 5155759 missense probably damaging 0.99
R4577:Pacs1 UTSW 19 5143833 nonsense probably null
R4630:Pacs1 UTSW 19 5156356 critical splice donor site probably null
R5029:Pacs1 UTSW 19 5142271 missense probably benign 0.03
R5198:Pacs1 UTSW 19 5139297 missense probably benign 0.33
R5223:Pacs1 UTSW 19 5145141 missense probably benign 0.00
R5464:Pacs1 UTSW 19 5147207 missense probably benign
R5695:Pacs1 UTSW 19 5136791 missense probably damaging 1.00
R6128:Pacs1 UTSW 19 5152372 splice site probably null
R6335:Pacs1 UTSW 19 5159977 missense probably damaging 1.00
R6802:Pacs1 UTSW 19 5152784 missense probably damaging 0.99
R6831:Pacs1 UTSW 19 5160795 missense probably damaging 1.00
R7071:Pacs1 UTSW 19 5156374 missense possibly damaging 0.69
R7200:Pacs1 UTSW 19 5156413 missense possibly damaging 0.71
R7248:Pacs1 UTSW 19 5138975 missense probably damaging 1.00
R7576:Pacs1 UTSW 19 5145120 missense probably benign 0.09
R7682:Pacs1 UTSW 19 5152699 missense probably damaging 0.99
R7715:Pacs1 UTSW 19 5141681 missense probably benign 0.01
R7738:Pacs1 UTSW 19 5152350 missense probably benign 0.11
R8930:Pacs1 UTSW 19 5135002 missense probably damaging 1.00
R8932:Pacs1 UTSW 19 5135002 missense probably damaging 1.00
R9043:Pacs1 UTSW 19 5138936 missense probably benign 0.23
R9211:Pacs1 UTSW 19 5139029 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCCCATCCTTGCTGTAGGAACC -3'
(R):5'- GCAGCACTTCCAACTTCCTG -3'

Sequencing Primer
(F):5'- CTGTAGGAACCAGGTCTGCTAAC -3'
(R):5'- TCCATAGACACCTGCCTGC -3'
Posted On 2020-09-02