Incidental Mutation 'R0024:Krt34'
ID 64483
Institutional Source Beutler Lab
Gene Symbol Krt34
Ensembl Gene ENSMUSG00000043485
Gene Name keratin 34
Synonyms 4733401E01Rik, Krt1-4
MMRRC Submission 038319-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.077) question?
Stock # R0024 (G1)
Quality Score 83
Status Validated
Chromosome 11
Chromosomal Location 99928173-99932380 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 99931863 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Serine at position 119 (C119S)
Ref Sequence ENSEMBL: ENSMUSP00000056622 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056362]
AlphaFold Q9D646
Predicted Effect probably benign
Transcript: ENSMUST00000056362
AA Change: C119S

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000056622
Gene: ENSMUSG00000043485
AA Change: C119S

DomainStartEndE-ValueType
low complexity region 11 26 N/A INTRINSIC
Filament 55 366 7.76e-151 SMART
low complexity region 378 392 N/A INTRINSIC
Meta Mutation Damage Score 0.1010 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the keratin gene family. As a type I hair keratin, it is an acidic protein which heterodimerizes with type II keratins to form hair and nails. [provided by RefSeq, Sep 2015]
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 A T 7: 120,032,608 (GRCm39) D209V probably damaging Het
Abtb3 A G 10: 85,223,311 (GRCm39) D40G unknown Het
Bbx T A 16: 50,045,281 (GRCm39) M427L probably benign Het
Camk2d A G 3: 126,591,372 (GRCm39) M281V probably benign Het
Chdh G A 14: 29,753,553 (GRCm39) R154H possibly damaging Het
Emid1 A T 11: 5,093,869 (GRCm39) W93R probably damaging Het
Grid2ip T A 5: 143,376,796 (GRCm39) S947T probably damaging Het
Gstt4 T A 10: 75,653,038 (GRCm39) M175L possibly damaging Het
Hectd4 C T 5: 121,446,639 (GRCm39) T242I possibly damaging Het
Hfm1 T C 5: 107,004,790 (GRCm39) K1179E probably benign Het
Kif13b A G 14: 64,987,722 (GRCm39) I750V probably benign Het
Krt6a A G 15: 101,599,150 (GRCm39) probably benign Het
Myof G T 19: 37,904,188 (GRCm39) T4N probably damaging Het
Or2r3 A G 6: 42,448,194 (GRCm39) M306T probably benign Het
P3h3 T C 6: 124,834,421 (GRCm39) Q77R probably benign Het
Picalm T C 7: 89,779,912 (GRCm39) probably null Het
Plcb1 A G 2: 135,204,345 (GRCm39) S900G probably benign Het
Prkd2 T C 7: 16,581,568 (GRCm39) L141P probably damaging Het
Prpf31 C A 7: 3,639,658 (GRCm39) probably null Het
Rgs5 T A 1: 169,504,461 (GRCm39) V37D probably damaging Het
Slc24a2 T C 4: 86,946,477 (GRCm39) probably benign Het
Ssh2 A T 11: 77,345,792 (GRCm39) Q1259L possibly damaging Het
Sugct G A 13: 17,032,454 (GRCm39) H433Y probably benign Het
Sycp2l A G 13: 41,295,264 (GRCm39) I310M probably damaging Het
Utrn A G 10: 12,281,755 (GRCm39) V3301A probably benign Het
Other mutations in Krt34
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00593:Krt34 APN 11 99,929,520 (GRCm39) splice site probably benign
IGL01323:Krt34 APN 11 99,929,606 (GRCm39) missense possibly damaging 0.95
IGL01403:Krt34 APN 11 99,929,116 (GRCm39) missense possibly damaging 0.88
IGL01453:Krt34 APN 11 99,930,916 (GRCm39) missense probably damaging 1.00
IGL02031:Krt34 APN 11 99,929,849 (GRCm39) missense possibly damaging 0.95
IGL02831:Krt34 APN 11 99,930,973 (GRCm39) splice site probably benign
R0024:Krt34 UTSW 11 99,931,863 (GRCm39) missense probably benign 0.01
R0220:Krt34 UTSW 11 99,929,519 (GRCm39) splice site probably benign
R0242:Krt34 UTSW 11 99,932,157 (GRCm39) missense probably damaging 1.00
R1573:Krt34 UTSW 11 99,931,854 (GRCm39) missense probably benign 0.01
R1714:Krt34 UTSW 11 99,930,953 (GRCm39) missense possibly damaging 0.95
R1879:Krt34 UTSW 11 99,929,118 (GRCm39) missense possibly damaging 0.76
R3084:Krt34 UTSW 11 99,931,847 (GRCm39) missense probably damaging 1.00
R3692:Krt34 UTSW 11 99,929,857 (GRCm39) missense probably damaging 1.00
R3819:Krt34 UTSW 11 99,930,844 (GRCm39) missense probably damaging 1.00
R3872:Krt34 UTSW 11 99,932,243 (GRCm39) missense probably benign
R3876:Krt34 UTSW 11 99,931,791 (GRCm39) missense probably benign 0.02
R6164:Krt34 UTSW 11 99,929,272 (GRCm39) nonsense probably null
R6338:Krt34 UTSW 11 99,929,316 (GRCm39) missense probably benign 0.00
R6457:Krt34 UTSW 11 99,930,916 (GRCm39) missense probably damaging 1.00
R7728:Krt34 UTSW 11 99,930,811 (GRCm39) critical splice donor site probably null
R7748:Krt34 UTSW 11 99,929,764 (GRCm39) missense probably damaging 1.00
R7903:Krt34 UTSW 11 99,932,321 (GRCm39) start codon destroyed probably null 0.42
R8458:Krt34 UTSW 11 99,930,901 (GRCm39) missense probably damaging 1.00
R8480:Krt34 UTSW 11 99,930,971 (GRCm39) critical splice acceptor site probably null
R9262:Krt34 UTSW 11 99,930,851 (GRCm39) missense probably benign 0.15
R9514:Krt34 UTSW 11 99,929,226 (GRCm39) missense probably damaging 1.00
Z1176:Krt34 UTSW 11 99,932,260 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACTGAAGGGCTAGGGTCTGAATACC -3'
(R):5'- ACCATGCAGTTCCTGAATGACCG -3'

Sequencing Primer
(F):5'- TTTATAGCCACACTCAGGAGAAG -3'
(R):5'- TTCCTGAATGACCGCCTGG -3'
Posted On 2013-08-06