Mutagenetix > Incidental Mutation

Incidental Mutation 'R0024:Krt34'

64483

Institutional Source

Beutler Lab

Gene Symbol

Krt34

Ensembl Gene

ENSMUSG00000043485

Gene Name

keratin 34

Synonyms

Krt1-4, 4733401E01Rik

MMRRC Submission

038319-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.076) question?

Stock #

R0024 (G1)

Quality Score

Status

Validated

Chromosome

Chromosomal Location

100037347-100041554 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 100041037 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Serine at position 119 (C119S)

Ref Sequence

ENSEMBL: ENSMUSP00000056622 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000056362]

AlphaFold

Q9D646

Predicted Effect

probably benign
Transcript: ENSMUST00000056362
AA Change: C119S

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000056622
Gene: ENSMUSG00000043485
AA Change: C119S

Domain	Start	End	E-Value	Type
low complexity region	11	26	N/A	INTRINSIC
Filament	55	366	7.76e-151	SMART
low complexity region	378	392	N/A	INTRINSIC

Meta Mutation Damage Score

0.1010

Coding Region Coverage

1x: 99.3%
3x: 98.8%
10x: 97.6%
20x: 95.9%

Validation Efficiency

98% (47/48)

MGI Phenotype

FUNCTION: The protein encoded by this gene is a member of the keratin gene family. As a type I hair keratin, it is an acidic protein which heterodimerizes with type II keratins to form hair and nails. [provided by RefSeq, Sep 2015]

Allele List at MGI

Other mutations in this stock

Total: 25 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca16	A	T	7: 120,433,385	D209V	probably damaging	Het
Bbx	T	A	16: 50,224,918	M427L	probably benign	Het
Btbd11	A	G	10: 85,387,447	D40G	unknown	Het
Camk2d	A	G	3: 126,797,723	M281V	probably benign	Het
Chdh	G	A	14: 30,031,596	R154H	possibly damaging	Het
Emid1	A	T	11: 5,143,869	W93R	probably damaging	Het
Grid2ip	T	A	5: 143,391,041	S947T	probably damaging	Het
Gstt4	T	A	10: 75,817,204	M175L	possibly damaging	Het
Hectd4	C	T	5: 121,308,576	T242I	possibly damaging	Het
Hfm1	T	C	5: 106,856,924	K1179E	probably benign	Het
Kif13b	A	G	14: 64,750,273	I750V	probably benign	Het
Krt6a	A	G	15: 101,690,715		probably benign	Het
Myof	G	T	19: 37,915,740	T4N	probably damaging	Het
Olfr457	A	G	6: 42,471,260	M306T	probably benign	Het
P3h3	T	C	6: 124,857,458	Q77R	probably benign	Het
Picalm	T	C	7: 90,130,704		probably null	Het
Plcb1	A	G	2: 135,362,425	S900G	probably benign	Het
Prkd2	T	C	7: 16,847,643	L141P	probably damaging	Het
Prpf31	C	A	7: 3,636,659		probably null	Het
Rgs5	T	A	1: 169,676,892	V37D	probably damaging	Het
Slc24a2	T	C	4: 87,028,240		probably benign	Het
Ssh2	A	T	11: 77,454,966	Q1259L	possibly damaging	Het
Sugct	G	A	13: 16,857,869	H433Y	probably benign	Het
Sycp2l	A	G	13: 41,141,788	I310M	probably damaging	Het
Utrn	A	G	10: 12,406,011	V3301A	probably benign	Het

Other mutations in Krt34

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00593:Krt34	APN	11	100038694	splice site	probably benign
IGL01323:Krt34	APN	11	100038780	missense	possibly damaging	0.95
IGL01403:Krt34	APN	11	100038290	missense	possibly damaging	0.88
IGL01453:Krt34	APN	11	100040090	missense	probably damaging	1.00
IGL02031:Krt34	APN	11	100039023	missense	possibly damaging	0.95
IGL02831:Krt34	APN	11	100040147	splice site	probably benign
R0024:Krt34	UTSW	11	100041037	missense	probably benign	0.01
R0220:Krt34	UTSW	11	100038693	splice site	probably benign
R0242:Krt34	UTSW	11	100041331	missense	probably damaging	1.00
R1573:Krt34	UTSW	11	100041028	missense	probably benign	0.01
R1714:Krt34	UTSW	11	100040127	missense	possibly damaging	0.95
R1879:Krt34	UTSW	11	100038292	missense	possibly damaging	0.76
R3084:Krt34	UTSW	11	100041021	missense	probably damaging	1.00
R3692:Krt34	UTSW	11	100039031	missense	probably damaging	1.00
R3819:Krt34	UTSW	11	100040018	missense	probably damaging	1.00
R3872:Krt34	UTSW	11	100041417	missense	probably benign
R3876:Krt34	UTSW	11	100040965	missense	probably benign	0.02
R6164:Krt34	UTSW	11	100038446	nonsense	probably null
R6338:Krt34	UTSW	11	100038490	missense	probably benign	0.00
R6457:Krt34	UTSW	11	100040090	missense	probably damaging	1.00
R7728:Krt34	UTSW	11	100039985	critical splice donor site	probably null
R7748:Krt34	UTSW	11	100038938	missense	probably damaging	1.00
R7903:Krt34	UTSW	11	100041495	start codon destroyed	probably null	0.42
R8458:Krt34	UTSW	11	100040075	missense	probably damaging	1.00
R8480:Krt34	UTSW	11	100040145	critical splice acceptor site	probably null
R9262:Krt34	UTSW	11	100040025	missense	probably benign	0.15
R9514:Krt34	UTSW	11	100038400	missense	probably damaging	1.00
Z1176:Krt34	UTSW	11	100041434	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- ACTGAAGGGCTAGGGTCTGAATACC -3'
(R):5'- ACCATGCAGTTCCTGAATGACCG -3'

Sequencing Primer
(F):5'- TTTATAGCCACACTCAGGAGAAG -3'
(R):5'- TTCCTGAATGACCGCCTGG -3'

Posted On

2013-08-06