Incidental Mutation 'R8340:Mkln1'
ID 644830
Institutional Source Beutler Lab
Gene Symbol Mkln1
Ensembl Gene ENSMUSG00000025609
Gene Name muskelin 1, intracellular mediator containing kelch motifs
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.751) question?
Stock # R8340 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 31398735-31516811 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 31432943 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Leucine at position 172 (R172L)
Ref Sequence ENSEMBL: ENSMUSP00000026699 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026699]
AlphaFold O89050
PDB Structure The crystal structure of discoidin domain from muskelin [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000026699
AA Change: R172L

PolyPhen 2 Score 0.532 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000026699
Gene: ENSMUSG00000025609
AA Change: R172L

DomainStartEndE-ValueType
Pfam:F5_F8_type_C 20 150 5.8e-11 PFAM
LisH 172 204 4.68e-3 SMART
CTLH 206 258 5.29e-2 SMART
Pfam:Kelch_4 270 324 5.8e-7 PFAM
Pfam:Kelch_1 279 315 2.2e-8 PFAM
Pfam:Kelch_3 282 334 7.6e-13 PFAM
Pfam:Kelch_1 459 498 2.8e-6 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Muskelin is an intracellular protein that acts as a mediator of cell spreading and cytoskeletal responses to the extracellular matrix component thrombospondin I (MIM 188060) (Adams et al., 1998 [PubMed 9724633]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit abnormal high-frequency ripple oscillation associated with GABA receptor internalization, intracellular trafficking, and degradation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110040N11Rik C T 7: 81,786,091 V91M probably damaging Het
Actr2 A G 11: 20,094,435 V57A possibly damaging Het
Aoah A G 13: 20,999,942 Y392C probably damaging Het
Armc6 T G 8: 70,220,852 N407T probably damaging Het
BC024139 A G 15: 76,121,470 V484A probably benign Het
Bdp1 A G 13: 100,065,968 V716A possibly damaging Het
C2cd2 T C 16: 97,868,813 E550G probably benign Het
Cbl A G 9: 44,159,000 S512P possibly damaging Het
Chac2 C G 11: 30,977,511 G136A probably damaging Het
Crhr2 C T 6: 55,102,846 V170M probably damaging Het
Cyp2c54 T A 19: 40,072,387 D104V possibly damaging Het
Dhtkd1 T A 2: 5,919,597 S402C probably damaging Het
Etv3 A G 3: 87,536,549 D480G possibly damaging Het
Fam186b A T 15: 99,279,714 I577K probably benign Het
Foxe1 T C 4: 46,344,437 Y82H possibly damaging Het
Gm11639 A G 11: 104,986,030 I4099V unknown Het
Gsdma T A 11: 98,666,595 V120E probably benign Het
Insig2 A T 1: 121,307,217 S153R probably damaging Het
Isx T A 8: 74,890,060 I105N probably damaging Het
Klra4 T A 6: 130,065,294 E3D probably benign Het
Myrf A T 19: 10,215,341 S605T probably benign Het
Nell1 T A 7: 50,220,273 D232E probably damaging Het
Nemf T G 12: 69,353,885 T139P possibly damaging Het
Nrd1 A C 4: 109,001,154 K108Q probably damaging Het
Olfr114 T C 17: 37,590,143 D70G probably damaging Het
Olfr139 G T 11: 74,045,025 P83Q probably damaging Het
Olfr95 G T 17: 37,211,184 T223N possibly damaging Het
Pcnx4 T C 12: 72,567,077 S599P probably damaging Het
Plscr2 A G 9: 92,291,077 N224S probably benign Het
Poln A G 5: 34,149,774 S28P probably damaging Het
Prr36 A G 8: 4,214,224 S481P unknown Het
Scrn1 G A 6: 54,534,533 A74V possibly damaging Het
Slc22a22 T A 15: 57,263,690 probably null Het
Srpr A G 9: 35,215,806 D592G probably damaging Het
Tnc T C 4: 64,007,799 N915D probably damaging Het
Trpm2 T A 10: 77,923,624 K1109* probably null Het
Tsks C T 7: 44,952,720 R287W probably damaging Het
Ush1c T G 7: 46,211,206 M456L probably benign Het
Usp38 A G 8: 80,985,402 V668A probably benign Het
Vmn2r117 T A 17: 23,460,537 Q571L probably benign Het
Vmn2r13 A T 5: 109,174,140 D230E probably benign Het
Vmn2r25 C T 6: 123,853,013 G60S probably benign Het
Vmn2r82 A G 10: 79,381,202 D456G probably benign Het
Zfp738 A C 13: 67,671,112 H253Q probably damaging Het
Other mutations in Mkln1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01138:Mkln1 APN 6 31432990 missense probably damaging 0.99
IGL01569:Mkln1 APN 6 31428128 splice site probably benign
IGL01882:Mkln1 APN 6 31451534 missense probably benign
IGL02009:Mkln1 APN 6 31449520 missense probably benign 0.02
IGL02160:Mkln1 APN 6 31492791 splice site probably benign
IGL02994:Mkln1 APN 6 31490443 missense probably damaging 1.00
IGL03105:Mkln1 APN 6 31459059 nonsense probably null
PIT4377001:Mkln1 UTSW 6 31474354 missense probably damaging 1.00
R0376:Mkln1 UTSW 6 31478018 missense probably benign 0.00
R0446:Mkln1 UTSW 6 31449504 missense probably damaging 0.98
R0518:Mkln1 UTSW 6 31468132 missense probably benign 0.00
R0600:Mkln1 UTSW 6 31432927 splice site probably benign
R1066:Mkln1 UTSW 6 31418987 missense possibly damaging 0.85
R1248:Mkln1 UTSW 6 31489368 missense probably damaging 1.00
R1717:Mkln1 UTSW 6 31507644 missense probably benign
R1921:Mkln1 UTSW 6 31428178 missense probably benign 0.22
R1978:Mkln1 UTSW 6 31490530 nonsense probably null
R3836:Mkln1 UTSW 6 31468336 missense probably damaging 1.00
R3895:Mkln1 UTSW 6 31507667 missense probably damaging 1.00
R4456:Mkln1 UTSW 6 31426772 missense probably damaging 1.00
R4513:Mkln1 UTSW 6 31433158 intron probably benign
R4737:Mkln1 UTSW 6 31426799 missense probably damaging 1.00
R4819:Mkln1 UTSW 6 31474486 missense probably benign 0.00
R4960:Mkln1 UTSW 6 31459006 missense probably damaging 1.00
R5291:Mkln1 UTSW 6 31490481 missense possibly damaging 0.78
R5364:Mkln1 UTSW 6 31496712 missense probably damaging 1.00
R5739:Mkln1 UTSW 6 31496702 missense probably benign 0.00
R5797:Mkln1 UTSW 6 31433069 missense probably benign 0.21
R5890:Mkln1 UTSW 6 31490547 missense probably benign 0.02
R5940:Mkln1 UTSW 6 31489372 missense probably damaging 1.00
R6132:Mkln1 UTSW 6 31431220 missense probably damaging 0.98
R6521:Mkln1 UTSW 6 31490544 missense probably damaging 1.00
R7362:Mkln1 UTSW 6 31468168 missense probably benign 0.31
R7711:Mkln1 UTSW 6 31492649 missense probably damaging 0.99
R8094:Mkln1 UTSW 6 31492653 nonsense probably null
R8379:Mkln1 UTSW 6 31458965 nonsense probably null
R8972:Mkln1 UTSW 6 31496746 missense probably damaging 1.00
R9403:Mkln1 UTSW 6 31432970 missense probably damaging 1.00
Z1176:Mkln1 UTSW 6 31398921 missense possibly damaging 0.74
Z1176:Mkln1 UTSW 6 31451554 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTACTTGACAGGTGAAAATAAAGGC -3'
(R):5'- TTTTCAATCAACTCCTCGCAAG -3'

Sequencing Primer
(F):5'- CAGATTTCTGAGTTCAAGGCCAGTC -3'
(R):5'- TCCTCGCAAGCATCAAAGTC -3'
Posted On 2020-09-02