Incidental Mutation 'R8340:Tsks'
ID644835
Institutional Source Beutler Lab
Gene Symbol Tsks
Ensembl Gene ENSMUSG00000059891
Gene Nametestis-specific serine kinase substrate
SynonymsTssks1, Stk22s1, Tsks, clone 4
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8340 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location44943204-44958035 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 44952720 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 287 (R287W)
Ref Sequence ENSEMBL: ENSMUSP00000112673 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080233] [ENSMUST00000120929] [ENSMUST00000207719]
Predicted Effect probably damaging
Transcript: ENSMUST00000080233
AA Change: R278W

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000079122
Gene: ENSMUSG00000059891
AA Change: R278W

DomainStartEndE-ValueType
Pfam:TSKS 26 525 5.7e-281 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000120929
AA Change: R287W

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000112673
Gene: ENSMUSG00000059891
AA Change: R287W

DomainStartEndE-ValueType
Pfam:TSKS 26 585 8.1e-297 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000207719
Predicted Effect probably benign
Transcript: ENSMUST00000208475
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene is a member of a small family of testis-specific serine/threonine kinases. This gene may play a role in testicular physiology or spermiogenesis. Its expression is restricted to the testis during the last stages of spermatid maturation. Alternative splicing results in multiple transcript variants encoding distinct proteins. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110040N11Rik C T 7: 81,786,091 V91M probably damaging Het
Actr2 A G 11: 20,094,435 V57A possibly damaging Het
Aoah A G 13: 20,999,942 Y392C probably damaging Het
Armc6 T G 8: 70,220,852 N407T probably damaging Het
BC024139 A G 15: 76,121,470 V484A probably benign Het
Bdp1 A G 13: 100,065,968 V716A possibly damaging Het
C2cd2 T C 16: 97,868,813 E550G probably benign Het
Cbl A G 9: 44,159,000 S512P possibly damaging Het
Chac2 C G 11: 30,977,511 G136A probably damaging Het
Crhr2 C T 6: 55,102,846 V170M probably damaging Het
Cyp2c54 T A 19: 40,072,387 D104V possibly damaging Het
Dhtkd1 T A 2: 5,919,597 S402C probably damaging Het
Etv3 A G 3: 87,536,549 D480G possibly damaging Het
Fam186b A T 15: 99,279,714 I577K probably benign Het
Foxe1 T C 4: 46,344,437 Y82H possibly damaging Het
Gm11639 A G 11: 104,986,030 I4099V unknown Het
Gsdma T A 11: 98,666,595 V120E probably benign Het
Insig2 A T 1: 121,307,217 S153R probably damaging Het
Isx T A 8: 74,890,060 I105N probably damaging Het
Klra4 T A 6: 130,065,294 E3D probably benign Het
Mkln1 G T 6: 31,432,943 R172L possibly damaging Het
Myrf A T 19: 10,215,341 S605T probably benign Het
Nell1 T A 7: 50,220,273 D232E probably damaging Het
Nemf T G 12: 69,353,885 T139P possibly damaging Het
Nrd1 A C 4: 109,001,154 K108Q probably damaging Het
Olfr114 T C 17: 37,590,143 D70G probably damaging Het
Olfr139 G T 11: 74,045,025 P83Q probably damaging Het
Olfr95 G T 17: 37,211,184 T223N possibly damaging Het
Pcnx4 T C 12: 72,567,077 S599P probably damaging Het
Plscr2 A G 9: 92,291,077 N224S probably benign Het
Poln A G 5: 34,149,774 S28P probably damaging Het
Prr36 A G 8: 4,214,224 S481P unknown Het
Scrn1 G A 6: 54,534,533 A74V possibly damaging Het
Slc22a22 T A 15: 57,263,690 probably null Het
Srpr A G 9: 35,215,806 D592G probably damaging Het
Tnc T C 4: 64,007,799 N915D probably damaging Het
Trpm2 T A 10: 77,923,624 K1109* probably null Het
Ush1c T G 7: 46,211,206 M456L probably benign Het
Usp38 A G 8: 80,985,402 V668A probably benign Het
Vmn2r117 T A 17: 23,460,537 Q571L probably benign Het
Vmn2r13 A T 5: 109,174,140 D230E probably benign Het
Vmn2r25 C T 6: 123,853,013 G60S probably benign Het
Vmn2r82 A G 10: 79,381,202 D456G probably benign Het
Zfp738 A C 13: 67,671,112 H253Q probably damaging Het
Other mutations in Tsks
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01292:Tsks APN 7 44952558 missense probably damaging 1.00
IGL03006:Tsks APN 7 44950774 unclassified probably benign
IGL03065:Tsks APN 7 44943300 missense probably damaging 1.00
IGL03091:Tsks APN 7 44957895 missense possibly damaging 0.54
R0139:Tsks UTSW 7 44954459 missense probably benign
R0619:Tsks UTSW 7 44950834 missense probably damaging 1.00
R3709:Tsks UTSW 7 44951885 missense possibly damaging 0.62
R4273:Tsks UTSW 7 44957929 missense probably damaging 1.00
R4982:Tsks UTSW 7 44943994 missense possibly damaging 0.69
R5664:Tsks UTSW 7 44953784 missense probably damaging 1.00
R5846:Tsks UTSW 7 44943988 missense probably damaging 1.00
R6193:Tsks UTSW 7 44953839 missense probably damaging 0.96
R6567:Tsks UTSW 7 44953881 missense probably damaging 1.00
R7044:Tsks UTSW 7 44943792 missense probably damaging 0.99
R7255:Tsks UTSW 7 44952688 missense probably benign 0.13
R7845:Tsks UTSW 7 44953744 splice site probably null
R8073:Tsks UTSW 7 44957881 missense probably benign
R8162:Tsks UTSW 7 44953872 missense probably damaging 1.00
R8307:Tsks UTSW 7 44957662 missense
Predicted Primers PCR Primer
(F):5'- GCTAAGATACCTCCAGCAGC -3'
(R):5'- GGATTTACTCTGTCCGGTCC -3'

Sequencing Primer
(F):5'- CAACTGCAGGATGAGACGCC -3'
(R):5'- AGGCTCCAAGCTCCTCCTAG -3'
Posted On2020-09-02