Incidental Mutation 'R8340:Olfr114'
ID644864
Institutional Source Beutler Lab
Gene Symbol Olfr114
Ensembl Gene ENSMUSG00000062629
Gene Nameolfactory receptor 114
SynonymsMOR218-10, GA_x6K02T2PSCP-2049802-2048870
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R8340 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location37589233-37592743 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 37590143 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 70 (D70G)
Ref Sequence ENSEMBL: ENSMUSP00000151201 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076914] [ENSMUST00000214871] [ENSMUST00000216249]
Predicted Effect probably damaging
Transcript: ENSMUST00000076914
AA Change: D70G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000076181
Gene: ENSMUSG00000062629
AA Change: D70G

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 2e-43 PFAM
Pfam:7TM_GPCR_Srsx 35 305 3.7e-6 PFAM
Pfam:7tm_1 41 290 3e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214871
AA Change: D70G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000216249
AA Change: D70G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110040N11Rik C T 7: 81,786,091 V91M probably damaging Het
Actr2 A G 11: 20,094,435 V57A possibly damaging Het
Aoah A G 13: 20,999,942 Y392C probably damaging Het
Armc6 T G 8: 70,220,852 N407T probably damaging Het
BC024139 A G 15: 76,121,470 V484A probably benign Het
Bdp1 A G 13: 100,065,968 V716A possibly damaging Het
C2cd2 T C 16: 97,868,813 E550G probably benign Het
Cbl A G 9: 44,159,000 S512P possibly damaging Het
Chac2 C G 11: 30,977,511 G136A probably damaging Het
Crhr2 C T 6: 55,102,846 V170M probably damaging Het
Cyp2c54 T A 19: 40,072,387 D104V possibly damaging Het
Dhtkd1 T A 2: 5,919,597 S402C probably damaging Het
Etv3 A G 3: 87,536,549 D480G possibly damaging Het
Fam186b A T 15: 99,279,714 I577K probably benign Het
Foxe1 T C 4: 46,344,437 Y82H possibly damaging Het
Gm11639 A G 11: 104,986,030 I4099V unknown Het
Gsdma T A 11: 98,666,595 V120E probably benign Het
Insig2 A T 1: 121,307,217 S153R probably damaging Het
Isx T A 8: 74,890,060 I105N probably damaging Het
Klra4 T A 6: 130,065,294 E3D probably benign Het
Mkln1 G T 6: 31,432,943 R172L possibly damaging Het
Myrf A T 19: 10,215,341 S605T probably benign Het
Nell1 T A 7: 50,220,273 D232E probably damaging Het
Nemf T G 12: 69,353,885 T139P possibly damaging Het
Nrd1 A C 4: 109,001,154 K108Q probably damaging Het
Olfr139 G T 11: 74,045,025 P83Q probably damaging Het
Olfr95 G T 17: 37,211,184 T223N possibly damaging Het
Pcnx4 T C 12: 72,567,077 S599P probably damaging Het
Plscr2 A G 9: 92,291,077 N224S probably benign Het
Poln A G 5: 34,149,774 S28P probably damaging Het
Prr36 A G 8: 4,214,224 S481P unknown Het
Scrn1 G A 6: 54,534,533 A74V possibly damaging Het
Slc22a22 T A 15: 57,263,690 probably null Het
Srpr A G 9: 35,215,806 D592G probably damaging Het
Tnc T C 4: 64,007,799 N915D probably damaging Het
Trpm2 T A 10: 77,923,624 K1109* probably null Het
Tsks C T 7: 44,952,720 R287W probably damaging Het
Ush1c T G 7: 46,211,206 M456L probably benign Het
Usp38 A G 8: 80,985,402 V668A probably benign Het
Vmn2r117 T A 17: 23,460,537 Q571L probably benign Het
Vmn2r13 A T 5: 109,174,140 D230E probably benign Het
Vmn2r25 C T 6: 123,853,013 G60S probably benign Het
Vmn2r82 A G 10: 79,381,202 D456G probably benign Het
Zfp738 A C 13: 67,671,112 H253Q probably damaging Het
Other mutations in Olfr114
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01534:Olfr114 APN 17 37590072 missense possibly damaging 0.93
IGL01624:Olfr114 APN 17 37589925 missense probably benign 0.00
IGL02026:Olfr114 APN 17 37589407 utr 3 prime probably benign
IGL02608:Olfr114 APN 17 37590219 missense probably damaging 1.00
IGL02632:Olfr114 APN 17 37590341 missense probably benign 0.00
IGL02990:Olfr114 APN 17 37589668 missense probably benign 0.00
R0114:Olfr114 UTSW 17 37589415 makesense probably null
R1156:Olfr114 UTSW 17 37589517 missense possibly damaging 0.93
R1366:Olfr114 UTSW 17 37589764 missense probably benign 0.03
R3413:Olfr114 UTSW 17 37589696 missense probably benign 0.00
R3701:Olfr114 UTSW 17 37589826 nonsense probably null
R6122:Olfr114 UTSW 17 37589926 missense probably benign 0.12
R6639:Olfr114 UTSW 17 37589931 missense probably damaging 1.00
R7066:Olfr114 UTSW 17 37590143 missense probably damaging 1.00
R7316:Olfr114 UTSW 17 37590135 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCTACACTTTCTGGGACACATG -3'
(R):5'- GAGTGGATTCCTCCTCATGG -3'

Sequencing Primer
(F):5'- CTGGGACACATGATGATCTCATAGTG -3'
(R):5'- GGATTCTCTGACAACCATGAGCTG -3'
Posted On2020-09-02