Incidental Mutation 'R8341:Unc80'
ID 644868
Institutional Source Beutler Lab
Gene Symbol Unc80
Ensembl Gene ENSMUSG00000055567
Gene Name unc-80, NALCN activator
Synonyms C230061B10Rik, C030018G13Rik
MMRRC Submission 067865-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.891) question?
Stock # R8341 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 66507526-66738307 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 66688192 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 2397 (S2397P)
Ref Sequence ENSEMBL: ENSMUSP00000053692 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061620] [ENSMUST00000212557]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000061620
AA Change: S2397P

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000053692
Gene: ENSMUSG00000055567
AA Change: S2397P

DomainStartEndE-ValueType
Pfam:UNC80 16 236 2.2e-94 PFAM
low complexity region 372 385 N/A INTRINSIC
low complexity region 493 502 N/A INTRINSIC
low complexity region 693 711 N/A INTRINSIC
low complexity region 723 738 N/A INTRINSIC
low complexity region 739 769 N/A INTRINSIC
low complexity region 1038 1055 N/A INTRINSIC
low complexity region 1067 1084 N/A INTRINSIC
low complexity region 1309 1328 N/A INTRINSIC
low complexity region 1477 1489 N/A INTRINSIC
low complexity region 1676 1681 N/A INTRINSIC
low complexity region 1842 1848 N/A INTRINSIC
low complexity region 1854 1868 N/A INTRINSIC
low complexity region 2461 2480 N/A INTRINSIC
low complexity region 2726 2740 N/A INTRINSIC
low complexity region 3121 3144 N/A INTRINSIC
low complexity region 3245 3254 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000212557
AA Change: S2329P
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of a voltage-independent 'leak' ion-channel complex, in which it performs essential functions, such as serving as a bridge between two other components (sodium leak channel non-selective and UNC79) and as a scaffold for Src kinases. Leak channels play an importnat role in establishment and maintenance of resting membrane potentials in neurons. Mutations in this gene are associated with congenital infantile encephalopathy, intellectual disability and growth issues. [provided by RefSeq, Aug 2016]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b T A 11: 109,845,876 (GRCm39) I915F probably damaging Het
Adam11 C A 11: 102,667,362 (GRCm39) H641N probably damaging Het
Amfr A G 8: 94,725,806 (GRCm39) S192P probably damaging Het
Ano9 T A 7: 140,682,247 (GRCm39) N676I possibly damaging Het
Arfgef1 C T 1: 10,224,553 (GRCm39) V1428I probably benign Het
B3gnt9 C T 8: 105,980,497 (GRCm39) R297H probably benign Het
Bace2 C T 16: 97,158,108 (GRCm39) A36V possibly damaging Het
C1s1 C T 6: 124,508,115 (GRCm39) A625T probably damaging Het
Camkmt T C 17: 85,747,008 (GRCm39) L251P probably damaging Het
Ceacam15 C A 7: 16,405,928 (GRCm39) V208F probably benign Het
Clp1 T C 2: 84,554,117 (GRCm39) K351E probably damaging Het
Csmd3 T C 15: 47,561,547 (GRCm39) Y1343C Het
Cubn C A 2: 13,433,535 (GRCm39) G1125V probably damaging Het
Dpp4 C T 2: 62,178,234 (GRCm39) V633I probably benign Het
Eif2ak1 A T 5: 143,821,755 (GRCm39) D357V probably benign Het
Fez1 T C 9: 36,787,605 (GRCm39) M370T possibly damaging Het
Frk G A 10: 34,462,279 (GRCm39) E257K probably damaging Het
Gm7579 T A 7: 141,765,856 (GRCm39) C87* probably null Het
Henmt1 T C 3: 108,865,908 (GRCm39) V211A probably damaging Het
Hspg2 C G 4: 137,246,290 (GRCm39) P1023A possibly damaging Het
Ints9 T A 14: 65,273,863 (GRCm39) V556E probably benign Het
Itprid2 A T 2: 79,488,062 (GRCm39) K715I probably damaging Het
Klhl41 T C 2: 69,500,868 (GRCm39) S110P probably benign Het
Klrk1 T C 6: 129,599,663 (GRCm39) probably benign Het
Kmt2e A T 5: 23,704,451 (GRCm39) S1215C probably damaging Het
Lyn T C 4: 3,743,304 (GRCm39) probably null Het
Map2k5 T A 9: 63,246,380 (GRCm39) N116Y probably damaging Het
Map3k13 G T 16: 21,740,334 (GRCm39) E554* probably null Het
Map6 A G 7: 98,917,647 (GRCm39) E140G possibly damaging Het
Mpv17 A C 5: 31,311,447 (GRCm39) probably null Het
Myo1c C T 11: 75,562,253 (GRCm39) P883S probably benign Het
Myo7b T C 18: 32,116,979 (GRCm39) M914V probably benign Het
Olfm2 C T 9: 20,583,918 (GRCm39) probably null Het
Or2b4 G A 17: 38,116,543 (GRCm39) C169Y probably damaging Het
Osbpl7 T G 11: 96,950,989 (GRCm39) L612R probably damaging Het
Polq A T 16: 36,892,133 (GRCm39) M2012L possibly damaging Het
Ppp1r7 G A 1: 93,274,000 (GRCm39) D59N probably benign Het
Ppp4r3c2 A T X: 88,798,322 (GRCm39) K718M probably damaging Het
Ptbp1 A C 10: 79,699,045 (GRCm39) E534D probably benign Het
Qser1 A G 2: 104,619,820 (GRCm39) Y241H probably damaging Het
Rbx1 T C 15: 81,358,078 (GRCm39) L88P probably damaging Het
Rft1 T C 14: 30,411,838 (GRCm39) L462P probably damaging Het
Serpinb9f T A 13: 33,511,290 (GRCm39) L77* probably null Het
Shisa9 T C 16: 11,815,015 (GRCm39) M221T possibly damaging Het
Slc12a2 T G 18: 58,012,281 (GRCm39) F135V possibly damaging Het
Slc23a1 C T 18: 35,755,588 (GRCm39) G436E probably damaging Het
Slc44a2 T C 9: 21,253,495 (GRCm39) F88L probably benign Het
Snx21 A G 2: 164,633,805 (GRCm39) E197G probably damaging Het
Srarp T C 4: 141,160,707 (GRCm39) D42G possibly damaging Het
St6galnac1 T A 11: 116,659,714 (GRCm39) M200L probably benign Het
Stambpl1 A T 19: 34,211,401 (GRCm39) Q154L probably benign Het
Szt2 G T 4: 118,250,033 (GRCm39) R492S possibly damaging Het
Thbs3 G A 3: 89,132,698 (GRCm39) R880Q probably benign Het
Tnks A T 8: 35,340,199 (GRCm39) L473H probably damaging Het
Ttc4 A G 4: 106,522,893 (GRCm39) S342P probably benign Het
Uckl1 T A 2: 181,211,512 (GRCm39) M463L probably benign Het
Vmn2r73 T A 7: 85,507,128 (GRCm39) H728L probably benign Het
Vsig10l T C 7: 43,113,378 (GRCm39) V110A probably damaging Het
Zgrf1 T A 3: 127,354,564 (GRCm39) L61* probably null Het
Zswim5 A G 4: 116,843,989 (GRCm39) Y1009C probably damaging Het
Other mutations in Unc80
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Unc80 APN 1 66,693,554 (GRCm39) missense possibly damaging 0.53
IGL00340:Unc80 APN 1 66,645,618 (GRCm39) missense possibly damaging 0.73
IGL00783:Unc80 APN 1 66,647,596 (GRCm39) missense probably benign 0.37
IGL00784:Unc80 APN 1 66,647,596 (GRCm39) missense probably benign 0.37
IGL00935:Unc80 APN 1 66,666,425 (GRCm39) missense possibly damaging 0.53
IGL01094:Unc80 APN 1 66,734,592 (GRCm39) missense possibly damaging 0.90
IGL01466:Unc80 APN 1 66,661,645 (GRCm39) missense probably benign 0.33
IGL01577:Unc80 APN 1 66,569,127 (GRCm39) splice site probably null
IGL01626:Unc80 APN 1 66,590,213 (GRCm39) critical splice donor site probably null
IGL01640:Unc80 APN 1 66,718,744 (GRCm39) missense probably benign 0.33
IGL01775:Unc80 APN 1 66,640,215 (GRCm39) missense possibly damaging 0.94
IGL01960:Unc80 APN 1 66,647,659 (GRCm39) splice site probably benign
IGL01991:Unc80 APN 1 66,508,668 (GRCm39) nonsense probably null
IGL02022:Unc80 APN 1 66,665,675 (GRCm39) missense possibly damaging 0.53
IGL02073:Unc80 APN 1 66,651,386 (GRCm39) missense possibly damaging 0.85
IGL02077:Unc80 APN 1 66,564,875 (GRCm39) missense possibly damaging 0.77
IGL02197:Unc80 APN 1 66,569,224 (GRCm39) missense probably benign 0.39
IGL02198:Unc80 APN 1 66,569,145 (GRCm39) missense possibly damaging 0.88
IGL02228:Unc80 APN 1 66,647,587 (GRCm39) missense possibly damaging 0.72
IGL02327:Unc80 APN 1 66,680,832 (GRCm39) missense probably benign 0.33
IGL02447:Unc80 APN 1 66,542,703 (GRCm39) missense possibly damaging 0.86
IGL02489:Unc80 APN 1 66,564,860 (GRCm39) missense probably benign 0.07
IGL02546:Unc80 APN 1 66,594,112 (GRCm39) missense possibly damaging 0.83
IGL02629:Unc80 APN 1 66,522,476 (GRCm39) missense possibly damaging 0.46
IGL02631:Unc80 APN 1 66,569,222 (GRCm39) missense probably damaging 0.98
IGL02839:Unc80 APN 1 66,710,834 (GRCm39) missense possibly damaging 0.53
IGL02960:Unc80 APN 1 66,717,217 (GRCm39) splice site probably benign
IGL02974:Unc80 APN 1 66,564,817 (GRCm39) missense possibly damaging 0.95
IGL03060:Unc80 APN 1 66,676,169 (GRCm39) missense possibly damaging 0.96
IGL03062:Unc80 APN 1 66,548,648 (GRCm39) missense probably damaging 0.96
IGL03074:Unc80 APN 1 66,710,877 (GRCm39) splice site probably benign
IGL03086:Unc80 APN 1 66,548,633 (GRCm39) missense probably damaging 0.99
IGL03105:Unc80 APN 1 66,511,258 (GRCm39) missense probably damaging 0.96
IGL03107:Unc80 APN 1 66,670,613 (GRCm39) missense probably damaging 0.98
IGL03158:Unc80 APN 1 66,680,833 (GRCm39) missense probably benign 0.33
IGL03220:Unc80 APN 1 66,544,097 (GRCm39) missense probably damaging 0.99
IGL03271:Unc80 APN 1 66,734,762 (GRCm39) unclassified probably benign
IGL03332:Unc80 APN 1 66,542,790 (GRCm39) missense probably damaging 1.00
IGL03347:Unc80 APN 1 66,734,625 (GRCm39) missense probably damaging 1.00
R0012:Unc80 UTSW 1 66,546,550 (GRCm39) missense probably damaging 1.00
R0012:Unc80 UTSW 1 66,546,550 (GRCm39) missense probably damaging 1.00
R0026:Unc80 UTSW 1 66,560,743 (GRCm39) missense probably benign 0.27
R0055:Unc80 UTSW 1 66,545,782 (GRCm39) splice site probably benign
R0149:Unc80 UTSW 1 66,560,760 (GRCm39) missense possibly damaging 0.82
R0325:Unc80 UTSW 1 66,550,040 (GRCm39) missense probably damaging 1.00
R0329:Unc80 UTSW 1 66,713,246 (GRCm39) missense possibly damaging 0.96
R0330:Unc80 UTSW 1 66,713,246 (GRCm39) missense possibly damaging 0.96
R0355:Unc80 UTSW 1 66,589,015 (GRCm39) missense possibly damaging 0.77
R0412:Unc80 UTSW 1 66,590,096 (GRCm39) splice site probably benign
R0422:Unc80 UTSW 1 66,522,497 (GRCm39) missense probably damaging 1.00
R0477:Unc80 UTSW 1 66,609,160 (GRCm39) missense probably damaging 0.99
R0507:Unc80 UTSW 1 66,567,052 (GRCm39) missense possibly damaging 0.66
R0513:Unc80 UTSW 1 66,661,633 (GRCm39) missense possibly damaging 0.73
R0553:Unc80 UTSW 1 66,545,828 (GRCm39) missense probably damaging 0.97
R0626:Unc80 UTSW 1 66,647,601 (GRCm39) missense probably benign 0.01
R0655:Unc80 UTSW 1 66,542,940 (GRCm39) missense probably damaging 0.98
R0742:Unc80 UTSW 1 66,567,052 (GRCm39) missense possibly damaging 0.66
R0755:Unc80 UTSW 1 66,544,082 (GRCm39) missense probably damaging 1.00
R0782:Unc80 UTSW 1 66,661,740 (GRCm39) missense possibly damaging 0.53
R0837:Unc80 UTSW 1 66,688,103 (GRCm39) missense possibly damaging 0.73
R0841:Unc80 UTSW 1 66,511,247 (GRCm39) missense probably damaging 1.00
R0893:Unc80 UTSW 1 66,560,645 (GRCm39) missense probably damaging 0.97
R0900:Unc80 UTSW 1 66,710,757 (GRCm39) missense probably benign 0.33
R0924:Unc80 UTSW 1 66,549,800 (GRCm39) missense possibly damaging 0.95
R0930:Unc80 UTSW 1 66,549,800 (GRCm39) missense possibly damaging 0.95
R0989:Unc80 UTSW 1 66,685,599 (GRCm39) missense possibly damaging 0.53
R1145:Unc80 UTSW 1 66,511,247 (GRCm39) missense probably damaging 1.00
R1145:Unc80 UTSW 1 66,511,247 (GRCm39) missense probably damaging 1.00
R1224:Unc80 UTSW 1 66,511,139 (GRCm39) missense probably damaging 1.00
R1240:Unc80 UTSW 1 66,675,061 (GRCm39) missense possibly damaging 0.85
R1245:Unc80 UTSW 1 66,594,254 (GRCm39) missense possibly damaging 0.94
R1467:Unc80 UTSW 1 66,560,740 (GRCm39) missense possibly damaging 0.46
R1473:Unc80 UTSW 1 66,560,740 (GRCm39) missense possibly damaging 0.46
R1500:Unc80 UTSW 1 66,560,740 (GRCm39) missense possibly damaging 0.46
R1556:Unc80 UTSW 1 66,560,740 (GRCm39) missense possibly damaging 0.46
R1562:Unc80 UTSW 1 66,677,116 (GRCm39) missense probably damaging 1.00
R1655:Unc80 UTSW 1 66,711,915 (GRCm39) missense possibly damaging 0.86
R1674:Unc80 UTSW 1 66,548,467 (GRCm39) missense probably damaging 1.00
R1680:Unc80 UTSW 1 66,542,828 (GRCm39) nonsense probably null
R1739:Unc80 UTSW 1 66,567,051 (GRCm39) missense probably damaging 0.97
R1756:Unc80 UTSW 1 66,678,407 (GRCm39) missense possibly damaging 0.53
R1783:Unc80 UTSW 1 66,722,432 (GRCm39) missense probably benign 0.01
R1834:Unc80 UTSW 1 66,678,407 (GRCm39) missense possibly damaging 0.53
R1854:Unc80 UTSW 1 66,670,573 (GRCm39) missense possibly damaging 0.93
R1871:Unc80 UTSW 1 66,549,876 (GRCm39) missense possibly damaging 0.77
R1878:Unc80 UTSW 1 66,548,561 (GRCm39) missense probably damaging 0.96
R1883:Unc80 UTSW 1 66,564,929 (GRCm39) missense possibly damaging 0.89
R1912:Unc80 UTSW 1 66,549,784 (GRCm39) missense probably damaging 1.00
R1990:Unc80 UTSW 1 66,731,708 (GRCm39) missense probably damaging 0.97
R2007:Unc80 UTSW 1 66,542,935 (GRCm39) missense probably damaging 1.00
R2035:Unc80 UTSW 1 66,645,752 (GRCm39) missense probably damaging 0.98
R2056:Unc80 UTSW 1 66,679,711 (GRCm39) missense possibly damaging 0.72
R2060:Unc80 UTSW 1 66,679,754 (GRCm39) missense possibly damaging 0.53
R2074:Unc80 UTSW 1 66,718,903 (GRCm39) critical splice donor site probably null
R2088:Unc80 UTSW 1 66,629,386 (GRCm39) missense possibly damaging 0.77
R2089:Unc80 UTSW 1 66,710,874 (GRCm39) splice site probably benign
R2091:Unc80 UTSW 1 66,710,874 (GRCm39) splice site probably benign
R2139:Unc80 UTSW 1 66,560,740 (GRCm39) missense possibly damaging 0.46
R2169:Unc80 UTSW 1 66,560,740 (GRCm39) missense possibly damaging 0.46
R2175:Unc80 UTSW 1 66,716,514 (GRCm39) missense probably damaging 1.00
R2248:Unc80 UTSW 1 66,662,365 (GRCm39) splice site probably benign
R2255:Unc80 UTSW 1 66,657,417 (GRCm39) missense possibly damaging 0.53
R2308:Unc80 UTSW 1 66,688,156 (GRCm39) missense possibly damaging 0.53
R2484:Unc80 UTSW 1 66,560,740 (GRCm39) missense possibly damaging 0.46
R2507:Unc80 UTSW 1 66,651,266 (GRCm39) missense possibly damaging 0.53
R2512:Unc80 UTSW 1 66,710,767 (GRCm39) missense possibly damaging 0.70
R2878:Unc80 UTSW 1 66,710,735 (GRCm39) critical splice acceptor site probably benign
R3040:Unc80 UTSW 1 66,678,464 (GRCm39) missense probably benign 0.33
R3104:Unc80 UTSW 1 66,662,450 (GRCm39) missense probably benign 0.33
R3402:Unc80 UTSW 1 66,549,845 (GRCm39) missense probably damaging 0.97
R3403:Unc80 UTSW 1 66,549,845 (GRCm39) missense probably damaging 0.97
R3413:Unc80 UTSW 1 66,678,464 (GRCm39) missense probably benign 0.33
R3426:Unc80 UTSW 1 66,678,464 (GRCm39) missense probably benign 0.33
R3427:Unc80 UTSW 1 66,678,464 (GRCm39) missense probably benign 0.33
R3428:Unc80 UTSW 1 66,678,464 (GRCm39) missense probably benign 0.33
R3904:Unc80 UTSW 1 66,678,455 (GRCm39) nonsense probably null
R3916:Unc80 UTSW 1 66,716,654 (GRCm39) missense probably benign 0.11
R3950:Unc80 UTSW 1 66,661,729 (GRCm39) missense possibly damaging 0.53
R4642:Unc80 UTSW 1 66,710,873 (GRCm39) splice site probably null
R4646:Unc80 UTSW 1 66,708,394 (GRCm39) missense probably benign 0.03
R4655:Unc80 UTSW 1 66,710,821 (GRCm39) missense probably benign 0.18
R4662:Unc80 UTSW 1 66,685,595 (GRCm39) missense probably benign 0.01
R4720:Unc80 UTSW 1 66,549,951 (GRCm39) missense possibly damaging 0.92
R4736:Unc80 UTSW 1 66,688,831 (GRCm39) critical splice acceptor site probably null
R4795:Unc80 UTSW 1 66,567,100 (GRCm39) missense probably damaging 0.97
R4888:Unc80 UTSW 1 66,683,606 (GRCm39) missense probably damaging 0.98
R4917:Unc80 UTSW 1 66,685,709 (GRCm39) missense possibly damaging 0.86
R4918:Unc80 UTSW 1 66,685,709 (GRCm39) missense possibly damaging 0.86
R4983:Unc80 UTSW 1 66,713,891 (GRCm39) splice site probably null
R5051:Unc80 UTSW 1 66,548,636 (GRCm39) missense probably damaging 0.96
R5111:Unc80 UTSW 1 66,567,154 (GRCm39) missense possibly damaging 0.66
R5122:Unc80 UTSW 1 66,718,749 (GRCm39) missense possibly damaging 0.53
R5260:Unc80 UTSW 1 66,685,746 (GRCm39) missense possibly damaging 0.53
R5351:Unc80 UTSW 1 66,645,672 (GRCm39) missense possibly damaging 0.73
R5387:Unc80 UTSW 1 66,569,180 (GRCm39) missense possibly damaging 0.77
R5437:Unc80 UTSW 1 66,693,737 (GRCm39) missense possibly damaging 0.96
R5525:Unc80 UTSW 1 66,645,773 (GRCm39) missense possibly damaging 0.72
R5621:Unc80 UTSW 1 66,677,202 (GRCm39) missense possibly damaging 0.53
R5690:Unc80 UTSW 1 66,679,731 (GRCm39) missense probably benign 0.08
R5762:Unc80 UTSW 1 66,732,955 (GRCm39) missense possibly damaging 0.82
R5956:Unc80 UTSW 1 66,567,123 (GRCm39) missense probably damaging 0.97
R6005:Unc80 UTSW 1 66,666,416 (GRCm39) missense possibly damaging 0.53
R6025:Unc80 UTSW 1 66,734,727 (GRCm39) missense possibly damaging 0.90
R6033:Unc80 UTSW 1 66,512,419 (GRCm39) missense possibly damaging 0.92
R6033:Unc80 UTSW 1 66,512,419 (GRCm39) missense possibly damaging 0.92
R6117:Unc80 UTSW 1 66,714,226 (GRCm39) missense possibly damaging 0.72
R6156:Unc80 UTSW 1 66,651,409 (GRCm39) missense probably benign 0.01
R6157:Unc80 UTSW 1 66,693,188 (GRCm39) nonsense probably null
R6189:Unc80 UTSW 1 66,716,630 (GRCm39) missense probably benign 0.33
R6291:Unc80 UTSW 1 66,560,756 (GRCm39) missense possibly damaging 0.82
R6367:Unc80 UTSW 1 66,711,925 (GRCm39) missense probably benign 0.33
R6598:Unc80 UTSW 1 66,507,699 (GRCm39) critical splice donor site probably null
R6724:Unc80 UTSW 1 66,722,350 (GRCm39) missense possibly damaging 0.90
R6763:Unc80 UTSW 1 66,560,636 (GRCm39) missense probably benign 0.00
R6773:Unc80 UTSW 1 66,690,702 (GRCm39) missense probably benign 0.33
R6883:Unc80 UTSW 1 66,685,563 (GRCm39) missense probably benign 0.33
R6951:Unc80 UTSW 1 66,687,670 (GRCm39) missense possibly damaging 0.53
R6965:Unc80 UTSW 1 66,685,725 (GRCm39) missense probably benign 0.33
R6993:Unc80 UTSW 1 66,588,952 (GRCm39) missense possibly damaging 0.60
R7041:Unc80 UTSW 1 66,542,752 (GRCm39) missense probably benign 0.00
R7050:Unc80 UTSW 1 66,590,067 (GRCm39) splice site probably null
R7067:Unc80 UTSW 1 66,685,731 (GRCm39) missense possibly damaging 0.86
R7080:Unc80 UTSW 1 66,685,680 (GRCm39) missense possibly damaging 0.53
R7193:Unc80 UTSW 1 66,588,943 (GRCm39) missense possibly damaging 0.60
R7197:Unc80 UTSW 1 66,560,725 (GRCm39) nonsense probably null
R7278:Unc80 UTSW 1 66,591,368 (GRCm39) missense possibly damaging 0.82
R7290:Unc80 UTSW 1 66,640,356 (GRCm39) missense probably damaging 0.97
R7391:Unc80 UTSW 1 66,734,687 (GRCm39) missense probably benign 0.18
R7401:Unc80 UTSW 1 66,685,574 (GRCm39) missense possibly damaging 0.96
R7470:Unc80 UTSW 1 66,661,621 (GRCm39) missense probably benign 0.02
R7573:Unc80 UTSW 1 66,560,696 (GRCm39) missense probably damaging 1.00
R7637:Unc80 UTSW 1 66,711,843 (GRCm39) missense possibly damaging 0.86
R7678:Unc80 UTSW 1 66,688,881 (GRCm39) missense probably benign 0.33
R7697:Unc80 UTSW 1 66,677,104 (GRCm39) missense possibly damaging 0.93
R7746:Unc80 UTSW 1 66,716,544 (GRCm39) missense probably benign 0.33
R7768:Unc80 UTSW 1 66,549,754 (GRCm39) missense possibly damaging 0.56
R7796:Unc80 UTSW 1 66,542,873 (GRCm39) missense probably benign
R7855:Unc80 UTSW 1 66,522,508 (GRCm39) missense possibly damaging 0.78
R7878:Unc80 UTSW 1 66,640,300 (GRCm39) missense possibly damaging 0.88
R7879:Unc80 UTSW 1 66,549,866 (GRCm39) missense probably benign 0.00
R8024:Unc80 UTSW 1 66,645,803 (GRCm39) missense possibly damaging 0.86
R8026:Unc80 UTSW 1 66,522,463 (GRCm39) missense possibly damaging 0.92
R8115:Unc80 UTSW 1 66,688,072 (GRCm39) missense probably benign 0.00
R8135:Unc80 UTSW 1 66,548,446 (GRCm39) missense possibly damaging 0.49
R8170:Unc80 UTSW 1 66,690,692 (GRCm39) missense probably benign 0.33
R8239:Unc80 UTSW 1 66,693,178 (GRCm39) missense probably benign
R8249:Unc80 UTSW 1 66,658,650 (GRCm39) missense probably benign 0.01
R8275:Unc80 UTSW 1 66,679,773 (GRCm39) nonsense probably null
R8288:Unc80 UTSW 1 66,512,509 (GRCm39) missense probably benign 0.07
R8356:Unc80 UTSW 1 66,680,788 (GRCm39) missense possibly damaging 0.85
R8433:Unc80 UTSW 1 66,677,187 (GRCm39) nonsense probably null
R8456:Unc80 UTSW 1 66,680,788 (GRCm39) missense possibly damaging 0.85
R8464:Unc80 UTSW 1 66,512,423 (GRCm39) missense probably damaging 1.00
R8483:Unc80 UTSW 1 66,732,869 (GRCm39) missense possibly damaging 0.83
R8509:Unc80 UTSW 1 66,680,788 (GRCm39) missense possibly damaging 0.85
R8686:Unc80 UTSW 1 66,651,427 (GRCm39) missense possibly damaging 0.53
R8701:Unc80 UTSW 1 66,677,191 (GRCm39) missense possibly damaging 0.85
R8729:Unc80 UTSW 1 66,647,649 (GRCm39) missense probably benign 0.01
R8755:Unc80 UTSW 1 66,651,290 (GRCm39) missense possibly damaging 0.53
R8771:Unc80 UTSW 1 66,685,554 (GRCm39) missense possibly damaging 0.85
R8866:Unc80 UTSW 1 66,629,388 (GRCm39) missense probably benign 0.05
R8877:Unc80 UTSW 1 66,567,144 (GRCm39) missense possibly damaging 0.89
R8942:Unc80 UTSW 1 66,512,468 (GRCm39) missense possibly damaging 0.94
R8976:Unc80 UTSW 1 66,511,169 (GRCm39) missense possibly damaging 0.87
R9063:Unc80 UTSW 1 66,645,816 (GRCm39) critical splice donor site probably null
R9095:Unc80 UTSW 1 66,545,912 (GRCm39) missense probably damaging 1.00
R9125:Unc80 UTSW 1 66,718,740 (GRCm39) missense probably benign 0.18
R9130:Unc80 UTSW 1 66,677,244 (GRCm39) missense possibly damaging 0.85
R9165:Unc80 UTSW 1 66,589,000 (GRCm39) missense probably null 0.95
R9220:Unc80 UTSW 1 66,546,534 (GRCm39) missense probably damaging 1.00
R9262:Unc80 UTSW 1 66,594,411 (GRCm39) intron probably benign
R9334:Unc80 UTSW 1 66,688,919 (GRCm39) missense possibly damaging 0.73
R9374:Unc80 UTSW 1 66,629,460 (GRCm39) missense possibly damaging 0.95
R9387:Unc80 UTSW 1 66,589,097 (GRCm39) critical splice donor site probably null
R9415:Unc80 UTSW 1 66,550,064 (GRCm39) missense
R9427:Unc80 UTSW 1 66,594,158 (GRCm39) missense probably damaging 1.00
R9436:Unc80 UTSW 1 66,732,964 (GRCm39) critical splice donor site probably null
R9454:Unc80 UTSW 1 66,734,749 (GRCm39) missense possibly damaging 0.53
R9522:Unc80 UTSW 1 66,677,221 (GRCm39) missense possibly damaging 0.73
R9539:Unc80 UTSW 1 66,609,163 (GRCm39) critical splice donor site probably null
R9552:Unc80 UTSW 1 66,717,282 (GRCm39) missense possibly damaging 0.85
R9667:Unc80 UTSW 1 66,651,287 (GRCm39) missense possibly damaging 0.86
R9720:Unc80 UTSW 1 66,683,485 (GRCm39) missense possibly damaging 0.53
R9749:Unc80 UTSW 1 66,544,179 (GRCm39) missense probably damaging 0.99
R9789:Unc80 UTSW 1 66,651,371 (GRCm39) missense possibly damaging 0.53
X0019:Unc80 UTSW 1 66,687,541 (GRCm39) missense probably benign 0.33
X0021:Unc80 UTSW 1 66,548,425 (GRCm39) critical splice acceptor site probably null
X0024:Unc80 UTSW 1 66,530,205 (GRCm39) missense probably benign 0.21
X0062:Unc80 UTSW 1 66,662,418 (GRCm39) missense probably benign 0.02
X0066:Unc80 UTSW 1 66,569,916 (GRCm39) missense possibly damaging 0.77
Y4335:Unc80 UTSW 1 66,560,740 (GRCm39) missense possibly damaging 0.46
Y4336:Unc80 UTSW 1 66,560,740 (GRCm39) missense possibly damaging 0.46
Y4338:Unc80 UTSW 1 66,560,740 (GRCm39) missense possibly damaging 0.46
Z1088:Unc80 UTSW 1 66,685,610 (GRCm39) missense possibly damaging 0.85
Z1176:Unc80 UTSW 1 66,733,568 (GRCm39) missense probably benign
Z1177:Unc80 UTSW 1 66,734,498 (GRCm39) missense probably benign 0.03
Z1177:Unc80 UTSW 1 66,685,557 (GRCm39) missense possibly damaging 0.72
Predicted Primers PCR Primer
(F):5'- CAATCAATGAACTGAAAGTGGTGTC -3'
(R):5'- ACGGAGGATTCCTTATTCTGTAG -3'

Sequencing Primer
(F):5'- CAATGAACTGAAAGTGGTGTCTTTTG -3'
(R):5'- CACTCAATGTGTAACATTGTTC -3'
Posted On 2020-09-02