Incidental Mutation 'R8341:Itprid2'
ID 644873
Institutional Source Beutler Lab
Gene Symbol Itprid2
Ensembl Gene ENSMUSG00000027007
Gene Name ITPR interacting domain containing 2
Synonyms Ssfa2, CS1, CS-1, SPAG13, KRAP
MMRRC Submission 067865-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.493) question?
Stock # R8341 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 79465696-79503310 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 79488062 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Isoleucine at position 715 (K715I)
Ref Sequence ENSEMBL: ENSMUSP00000107415 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111784] [ENSMUST00000111785] [ENSMUST00000111788]
AlphaFold Q922B9
Predicted Effect probably damaging
Transcript: ENSMUST00000111784
AA Change: K715I

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000107414
Gene: ENSMUSG00000027007
AA Change: K715I

DomainStartEndE-ValueType
low complexity region 35 57 N/A INTRINSIC
KRAP_IP3R_bind 144 302 6.78e-81 SMART
low complexity region 357 374 N/A INTRINSIC
low complexity region 423 445 N/A INTRINSIC
low complexity region 743 759 N/A INTRINSIC
Pfam:SSFA2_C 858 1029 7.5e-88 PFAM
low complexity region 1081 1095 N/A INTRINSIC
low complexity region 1144 1156 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111785
AA Change: K715I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107415
Gene: ENSMUSG00000027007
AA Change: K715I

DomainStartEndE-ValueType
low complexity region 35 57 N/A INTRINSIC
KRAP_IP3R_bind 144 302 6.78e-81 SMART
low complexity region 357 374 N/A INTRINSIC
low complexity region 423 445 N/A INTRINSIC
low complexity region 743 759 N/A INTRINSIC
Pfam:SSFA2_C 861 1029 8.9e-83 PFAM
low complexity region 1103 1117 N/A INTRINSIC
low complexity region 1166 1178 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111788
AA Change: K715I

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000107418
Gene: ENSMUSG00000027007
AA Change: K715I

DomainStartEndE-ValueType
low complexity region 35 57 N/A INTRINSIC
KRAP_IP3R_bind 144 302 6.78e-81 SMART
low complexity region 357 374 N/A INTRINSIC
low complexity region 423 445 N/A INTRINSIC
low complexity region 743 759 N/A INTRINSIC
Pfam:SSFA2_C 858 1029 7.4e-88 PFAM
low complexity region 1103 1117 N/A INTRINSIC
low complexity region 1166 1178 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 98% (57/58)
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation display decreased body weight, resistance to diet induced obesity, increased food intake, decreased adipose tissue mass, elevated metabolic rate, abnormal glucose homeostasis, and abnormal hormone levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b T A 11: 109,845,876 (GRCm39) I915F probably damaging Het
Adam11 C A 11: 102,667,362 (GRCm39) H641N probably damaging Het
Amfr A G 8: 94,725,806 (GRCm39) S192P probably damaging Het
Ano9 T A 7: 140,682,247 (GRCm39) N676I possibly damaging Het
Arfgef1 C T 1: 10,224,553 (GRCm39) V1428I probably benign Het
B3gnt9 C T 8: 105,980,497 (GRCm39) R297H probably benign Het
Bace2 C T 16: 97,158,108 (GRCm39) A36V possibly damaging Het
C1s1 C T 6: 124,508,115 (GRCm39) A625T probably damaging Het
Camkmt T C 17: 85,747,008 (GRCm39) L251P probably damaging Het
Ceacam15 C A 7: 16,405,928 (GRCm39) V208F probably benign Het
Clp1 T C 2: 84,554,117 (GRCm39) K351E probably damaging Het
Csmd3 T C 15: 47,561,547 (GRCm39) Y1343C Het
Cubn C A 2: 13,433,535 (GRCm39) G1125V probably damaging Het
Dpp4 C T 2: 62,178,234 (GRCm39) V633I probably benign Het
Eif2ak1 A T 5: 143,821,755 (GRCm39) D357V probably benign Het
Fez1 T C 9: 36,787,605 (GRCm39) M370T possibly damaging Het
Frk G A 10: 34,462,279 (GRCm39) E257K probably damaging Het
Gm7579 T A 7: 141,765,856 (GRCm39) C87* probably null Het
Henmt1 T C 3: 108,865,908 (GRCm39) V211A probably damaging Het
Hspg2 C G 4: 137,246,290 (GRCm39) P1023A possibly damaging Het
Ints9 T A 14: 65,273,863 (GRCm39) V556E probably benign Het
Klhl41 T C 2: 69,500,868 (GRCm39) S110P probably benign Het
Klrk1 T C 6: 129,599,663 (GRCm39) probably benign Het
Kmt2e A T 5: 23,704,451 (GRCm39) S1215C probably damaging Het
Lyn T C 4: 3,743,304 (GRCm39) probably null Het
Map2k5 T A 9: 63,246,380 (GRCm39) N116Y probably damaging Het
Map3k13 G T 16: 21,740,334 (GRCm39) E554* probably null Het
Map6 A G 7: 98,917,647 (GRCm39) E140G possibly damaging Het
Mpv17 A C 5: 31,311,447 (GRCm39) probably null Het
Myo1c C T 11: 75,562,253 (GRCm39) P883S probably benign Het
Myo7b T C 18: 32,116,979 (GRCm39) M914V probably benign Het
Olfm2 C T 9: 20,583,918 (GRCm39) probably null Het
Or2b4 G A 17: 38,116,543 (GRCm39) C169Y probably damaging Het
Osbpl7 T G 11: 96,950,989 (GRCm39) L612R probably damaging Het
Polq A T 16: 36,892,133 (GRCm39) M2012L possibly damaging Het
Ppp1r7 G A 1: 93,274,000 (GRCm39) D59N probably benign Het
Ppp4r3c2 A T X: 88,798,322 (GRCm39) K718M probably damaging Het
Ptbp1 A C 10: 79,699,045 (GRCm39) E534D probably benign Het
Qser1 A G 2: 104,619,820 (GRCm39) Y241H probably damaging Het
Rbx1 T C 15: 81,358,078 (GRCm39) L88P probably damaging Het
Rft1 T C 14: 30,411,838 (GRCm39) L462P probably damaging Het
Serpinb9f T A 13: 33,511,290 (GRCm39) L77* probably null Het
Shisa9 T C 16: 11,815,015 (GRCm39) M221T possibly damaging Het
Slc12a2 T G 18: 58,012,281 (GRCm39) F135V possibly damaging Het
Slc23a1 C T 18: 35,755,588 (GRCm39) G436E probably damaging Het
Slc44a2 T C 9: 21,253,495 (GRCm39) F88L probably benign Het
Snx21 A G 2: 164,633,805 (GRCm39) E197G probably damaging Het
Srarp T C 4: 141,160,707 (GRCm39) D42G possibly damaging Het
St6galnac1 T A 11: 116,659,714 (GRCm39) M200L probably benign Het
Stambpl1 A T 19: 34,211,401 (GRCm39) Q154L probably benign Het
Szt2 G T 4: 118,250,033 (GRCm39) R492S possibly damaging Het
Thbs3 G A 3: 89,132,698 (GRCm39) R880Q probably benign Het
Tnks A T 8: 35,340,199 (GRCm39) L473H probably damaging Het
Ttc4 A G 4: 106,522,893 (GRCm39) S342P probably benign Het
Uckl1 T A 2: 181,211,512 (GRCm39) M463L probably benign Het
Unc80 T C 1: 66,688,192 (GRCm39) S2397P possibly damaging Het
Vmn2r73 T A 7: 85,507,128 (GRCm39) H728L probably benign Het
Vsig10l T C 7: 43,113,378 (GRCm39) V110A probably damaging Het
Zgrf1 T A 3: 127,354,564 (GRCm39) L61* probably null Het
Zswim5 A G 4: 116,843,989 (GRCm39) Y1009C probably damaging Het
Other mutations in Itprid2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00785:Itprid2 APN 2 79,487,612 (GRCm39) missense possibly damaging 0.94
IGL00792:Itprid2 APN 2 79,487,807 (GRCm39) missense probably benign 0.01
IGL00900:Itprid2 APN 2 79,490,822 (GRCm39) missense probably damaging 1.00
IGL00902:Itprid2 APN 2 79,490,822 (GRCm39) missense probably damaging 1.00
IGL01682:Itprid2 APN 2 79,465,981 (GRCm39) missense probably damaging 1.00
IGL01683:Itprid2 APN 2 79,501,069 (GRCm39) intron probably benign
IGL01832:Itprid2 APN 2 79,481,762 (GRCm39) missense possibly damaging 0.94
IGL02253:Itprid2 APN 2 79,490,788 (GRCm39) missense probably damaging 1.00
IGL02342:Itprid2 APN 2 79,490,629 (GRCm39) missense probably benign 0.01
IGL02420:Itprid2 APN 2 79,465,986 (GRCm39) missense probably damaging 0.99
IGL02445:Itprid2 APN 2 79,487,842 (GRCm39) missense probably damaging 0.98
IGL02649:Itprid2 APN 2 79,472,303 (GRCm39) splice site probably benign
IGL03242:Itprid2 APN 2 79,473,815 (GRCm39) nonsense probably null
IGL03266:Itprid2 APN 2 79,472,534 (GRCm39) critical splice donor site probably null
IGL03342:Itprid2 APN 2 79,490,796 (GRCm39) missense probably damaging 1.00
IGL03352:Itprid2 APN 2 79,475,445 (GRCm39) missense probably damaging 1.00
R0255:Itprid2 UTSW 2 79,490,810 (GRCm39) missense probably damaging 1.00
R0526:Itprid2 UTSW 2 79,487,690 (GRCm39) missense probably benign 0.01
R0543:Itprid2 UTSW 2 79,474,850 (GRCm39) missense possibly damaging 0.79
R1114:Itprid2 UTSW 2 79,487,873 (GRCm39) missense probably damaging 1.00
R1701:Itprid2 UTSW 2 79,466,394 (GRCm39) missense probably damaging 1.00
R1734:Itprid2 UTSW 2 79,488,166 (GRCm39) missense probably damaging 1.00
R1945:Itprid2 UTSW 2 79,492,996 (GRCm39) missense probably benign 0.03
R2188:Itprid2 UTSW 2 79,475,267 (GRCm39) missense probably benign 0.01
R2941:Itprid2 UTSW 2 79,466,000 (GRCm39) missense probably benign 0.19
R4087:Itprid2 UTSW 2 79,488,691 (GRCm39) nonsense probably null
R4107:Itprid2 UTSW 2 79,475,175 (GRCm39) missense probably damaging 0.97
R4355:Itprid2 UTSW 2 79,472,342 (GRCm39) missense probably benign 0.02
R4497:Itprid2 UTSW 2 79,488,164 (GRCm39) missense probably damaging 1.00
R4615:Itprid2 UTSW 2 79,492,726 (GRCm39) missense probably damaging 0.99
R4726:Itprid2 UTSW 2 79,493,101 (GRCm39) missense probably damaging 1.00
R5818:Itprid2 UTSW 2 79,474,937 (GRCm39) missense probably damaging 1.00
R5889:Itprid2 UTSW 2 79,488,072 (GRCm39) missense probably damaging 1.00
R6169:Itprid2 UTSW 2 79,475,406 (GRCm39) missense probably damaging 0.99
R6337:Itprid2 UTSW 2 79,485,463 (GRCm39) missense probably damaging 1.00
R6677:Itprid2 UTSW 2 79,485,445 (GRCm39) missense possibly damaging 0.92
R6709:Itprid2 UTSW 2 79,475,276 (GRCm39) missense probably benign 0.00
R6855:Itprid2 UTSW 2 79,488,049 (GRCm39) missense probably damaging 1.00
R6856:Itprid2 UTSW 2 79,488,049 (GRCm39) missense probably damaging 1.00
R7075:Itprid2 UTSW 2 79,466,004 (GRCm39) missense probably damaging 0.99
R7319:Itprid2 UTSW 2 79,466,416 (GRCm39) missense probably damaging 1.00
R7414:Itprid2 UTSW 2 79,475,072 (GRCm39) missense possibly damaging 0.95
R7590:Itprid2 UTSW 2 79,488,454 (GRCm39) missense possibly damaging 0.88
R7722:Itprid2 UTSW 2 79,492,689 (GRCm39) missense probably damaging 1.00
R7923:Itprid2 UTSW 2 79,492,959 (GRCm39) nonsense probably null
R8155:Itprid2 UTSW 2 79,475,177 (GRCm39) missense probably benign 0.01
R8175:Itprid2 UTSW 2 79,488,496 (GRCm39) missense probably damaging 1.00
R8237:Itprid2 UTSW 2 79,487,614 (GRCm39) missense probably benign 0.01
R8353:Itprid2 UTSW 2 79,475,129 (GRCm39) missense probably benign 0.01
R8364:Itprid2 UTSW 2 79,481,787 (GRCm39) missense probably damaging 0.99
R8365:Itprid2 UTSW 2 79,492,689 (GRCm39) missense probably damaging 1.00
R8453:Itprid2 UTSW 2 79,475,129 (GRCm39) missense probably benign 0.01
R8507:Itprid2 UTSW 2 79,475,208 (GRCm39) missense probably benign
R8874:Itprid2 UTSW 2 79,487,684 (GRCm39) missense probably benign
R8953:Itprid2 UTSW 2 79,490,839 (GRCm39) missense probably damaging 1.00
R8978:Itprid2 UTSW 2 79,491,257 (GRCm39) missense probably damaging 1.00
R9033:Itprid2 UTSW 2 79,465,938 (GRCm39) missense probably damaging 0.97
R9067:Itprid2 UTSW 2 79,475,180 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTGAATTTGCCCAGTACACCAC -3'
(R):5'- TGACCATCGTGTTCAGTTCC -3'

Sequencing Primer
(F):5'- ACACACCATATTCTCAGATCCTTGG -3'
(R):5'- CAGGTCTTGTTCCTCTTCGGG -3'
Posted On 2020-09-02